ID: 1056396117

View in Genome Browser
Species Human (GRCh38)
Location 9:86182698-86182720
Sequence TTGGGGTATGTTTTATGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396109_1056396117 20 Left 1056396109 9:86182655-86182677 CCTGACACCAGTCTAATAATAAG No data
Right 1056396117 9:86182698-86182720 TTGGGGTATGTTTTATGGTTAGG No data
1056396107_1056396117 28 Left 1056396107 9:86182647-86182669 CCAAAAACCCTGACACCAGTCTA No data
Right 1056396117 9:86182698-86182720 TTGGGGTATGTTTTATGGTTAGG No data
1056396108_1056396117 21 Left 1056396108 9:86182654-86182676 CCCTGACACCAGTCTAATAATAA No data
Right 1056396117 9:86182698-86182720 TTGGGGTATGTTTTATGGTTAGG No data
1056396110_1056396117 13 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396117 9:86182698-86182720 TTGGGGTATGTTTTATGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396117 Original CRISPR TTGGGGTATGTTTTATGGTT AGG Intergenic
No off target data available for this crispr