ID: 1056396358

View in Genome Browser
Species Human (GRCh38)
Location 9:86185121-86185143
Sequence CATGCTTTTCAGCTGTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396358_1056396360 -3 Left 1056396358 9:86185121-86185143 CCACAATACAGCTGAAAAGCATG No data
Right 1056396360 9:86185141-86185163 ATGTGCACCTGCCCATGTGAGGG No data
1056396358_1056396364 8 Left 1056396358 9:86185121-86185143 CCACAATACAGCTGAAAAGCATG No data
Right 1056396364 9:86185152-86185174 CCCATGTGAGGGAGGTGCAAAGG No data
1056396358_1056396367 25 Left 1056396358 9:86185121-86185143 CCACAATACAGCTGAAAAGCATG No data
Right 1056396367 9:86185169-86185191 CAAAGGTGGTTGAGAGCAAGTGG No data
1056396358_1056396359 -4 Left 1056396358 9:86185121-86185143 CCACAATACAGCTGAAAAGCATG No data
Right 1056396359 9:86185140-86185162 CATGTGCACCTGCCCATGTGAGG No data
1056396358_1056396366 11 Left 1056396358 9:86185121-86185143 CCACAATACAGCTGAAAAGCATG No data
Right 1056396366 9:86185155-86185177 ATGTGAGGGAGGTGCAAAGGTGG No data
1056396358_1056396361 0 Left 1056396358 9:86185121-86185143 CCACAATACAGCTGAAAAGCATG No data
Right 1056396361 9:86185144-86185166 TGCACCTGCCCATGTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396358 Original CRISPR CATGCTTTTCAGCTGTATTG TGG (reversed) Intergenic
No off target data available for this crispr