ID: 1056396365

View in Genome Browser
Species Human (GRCh38)
Location 9:86185153-86185175
Sequence ACCTTTGCACCTCCCTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396365_1056396374 25 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396374 9:86185201-86185223 TGGATGAGTATGGGGAGAAGGGG No data
1056396365_1056396371 17 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396371 9:86185193-86185215 AATGTGTGTGGATGAGTATGGGG No data
1056396365_1056396368 5 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396368 9:86185181-86185203 AGAGCAAGTGGTAATGTGTGTGG No data
1056396365_1056396369 15 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396369 9:86185191-86185213 GTAATGTGTGTGGATGAGTATGG No data
1056396365_1056396370 16 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396370 9:86185192-86185214 TAATGTGTGTGGATGAGTATGGG No data
1056396365_1056396376 30 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396376 9:86185206-86185228 GAGTATGGGGAGAAGGGGCTGGG No data
1056396365_1056396373 24 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396373 9:86185200-86185222 GTGGATGAGTATGGGGAGAAGGG No data
1056396365_1056396367 -7 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396367 9:86185169-86185191 CAAAGGTGGTTGAGAGCAAGTGG No data
1056396365_1056396372 23 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396372 9:86185199-86185221 TGTGGATGAGTATGGGGAGAAGG No data
1056396365_1056396375 29 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396375 9:86185205-86185227 TGAGTATGGGGAGAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396365 Original CRISPR ACCTTTGCACCTCCCTCACA TGG (reversed) Intergenic
No off target data available for this crispr