ID: 1056396370

View in Genome Browser
Species Human (GRCh38)
Location 9:86185192-86185214
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396365_1056396370 16 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396370 9:86185192-86185214 TAATGTGTGTGGATGAGTATGGG No data
1056396363_1056396370 17 Left 1056396363 9:86185152-86185174 CCCATGTGAGGGAGGTGCAAAGG No data
Right 1056396370 9:86185192-86185214 TAATGTGTGTGGATGAGTATGGG No data
1056396362_1056396370 21 Left 1056396362 9:86185148-86185170 CCTGCCCATGTGAGGGAGGTGCA No data
Right 1056396370 9:86185192-86185214 TAATGTGTGTGGATGAGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396370 Original CRISPR TAATGTGTGTGGATGAGTAT GGG Intergenic
No off target data available for this crispr