ID: 1056396375

View in Genome Browser
Species Human (GRCh38)
Location 9:86185205-86185227
Sequence TGAGTATGGGGAGAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396363_1056396375 30 Left 1056396363 9:86185152-86185174 CCCATGTGAGGGAGGTGCAAAGG No data
Right 1056396375 9:86185205-86185227 TGAGTATGGGGAGAAGGGGCTGG No data
1056396365_1056396375 29 Left 1056396365 9:86185153-86185175 CCATGTGAGGGAGGTGCAAAGGT No data
Right 1056396375 9:86185205-86185227 TGAGTATGGGGAGAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396375 Original CRISPR TGAGTATGGGGAGAAGGGGC TGG Intergenic
No off target data available for this crispr