ID: 1056404604

View in Genome Browser
Species Human (GRCh38)
Location 9:86261692-86261714
Sequence GCCCTTGCCCCGCTAAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056404599_1056404604 21 Left 1056404599 9:86261648-86261670 CCCTCAAAGTAGGCTAGTTTTAA No data
Right 1056404604 9:86261692-86261714 GCCCTTGCCCCGCTAAAGGTTGG No data
1056404600_1056404604 20 Left 1056404600 9:86261649-86261671 CCTCAAAGTAGGCTAGTTTTAAG No data
Right 1056404604 9:86261692-86261714 GCCCTTGCCCCGCTAAAGGTTGG No data
1056404598_1056404604 30 Left 1056404598 9:86261639-86261661 CCATCAAGGCCCTCAAAGTAGGC No data
Right 1056404604 9:86261692-86261714 GCCCTTGCCCCGCTAAAGGTTGG No data
1056404602_1056404604 -10 Left 1056404602 9:86261679-86261701 CCGCTGGTACAGAGCCCTTGCCC No data
Right 1056404604 9:86261692-86261714 GCCCTTGCCCCGCTAAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056404604 Original CRISPR GCCCTTGCCCCGCTAAAGGT TGG Intergenic
No off target data available for this crispr