ID: 1056404975

View in Genome Browser
Species Human (GRCh38)
Location 9:86264900-86264922
Sequence GAACTTTAGCAACTGGACCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 3, 2: 0, 3: 7, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056404975 Original CRISPR GAACTTTAGCAACTGGACCG AGG Exonic
905744992 1:40408004-40408026 CAACTTTAGCAACTGGATTTGGG - Intronic
920425446 1:205871617-205871639 GTACTTTAACAACTGGAACTGGG - Intergenic
922684948 1:227631942-227631964 GTACTTTAACAACTGGAACTAGG - Intronic
1067868783 10:49938143-49938165 GAAGTGAAGCAACTGGACCAAGG - Intronic
1073937906 10:108656684-108656706 GAACTTTAGCTATTGGACTAGGG - Intergenic
1075552673 10:123403623-123403645 GAGCTTTGGCAACTTGACCATGG + Intergenic
1079934048 11:26596418-26596440 GTACTTTAACAACTGGAACTGGG - Intronic
1081070378 11:38603215-38603237 GTACTTTAACAACTGGAACTGGG + Intergenic
1081988480 11:47324695-47324717 GAACTGGAGCAGCTGGACCCAGG + Intronic
1086254882 11:84863852-84863874 GAGGTTAAGCAACTGGTCCGAGG - Intronic
1087281645 11:96217359-96217381 GAACTGTATCAACAGCACCGTGG - Intronic
1092293816 12:7182364-7182386 GTACTTTAACAACTGGAACTCGG + Intergenic
1099187491 12:79531781-79531803 GAACTTGAGCAACAGGAGCATGG - Intergenic
1100279154 12:93101621-93101643 GGACTTAAGCAAGTTGACCGAGG + Intergenic
1101016249 12:100503528-100503550 GAGCTCTTGCAACTGGACTGAGG + Intronic
1102714613 12:114959483-114959505 GAAGTTTAGCAACTTGGCCAAGG + Intergenic
1102884326 12:116510092-116510114 TAACTTTAGCAGCTGAGCCGAGG + Intergenic
1103796576 12:123507160-123507182 GCACTCTAGCAACTGTATCGTGG + Intronic
1104032900 12:125078196-125078218 GATCTTTACCAACTGCACAGGGG - Intronic
1106305289 13:28504178-28504200 GAAGATGAGCAACTGGACTGGGG - Intergenic
1107269682 13:38600465-38600487 GAAATTGAGCAACTGGGCTGAGG - Intergenic
1112242795 13:97698681-97698703 CAACTTTAGCAACTAGACTGTGG - Intergenic
1120051833 14:79876178-79876200 GAACTTGAGCATCTGGACTTTGG - Intergenic
1121115465 14:91339776-91339798 GAACCTCAGCAGCAGGACCGAGG + Intronic
1127325076 15:57886887-57886909 GACATTTAGGAACTGGACTGTGG - Intergenic
1128122456 15:65162818-65162840 GAATATTAGCAACTGGACAGCGG - Intronic
1131382757 15:91977589-91977611 GAACTTTGGCAACTGGAGTGTGG + Intronic
1135224363 16:20642685-20642707 GTACTTTAACAACTGGAACTGGG + Intronic
1140845661 16:78884694-78884716 GAACATTAGCAACATGACGGAGG - Intronic
1152409632 17:80116977-80116999 GGACTCTAGCACCTGGACTGTGG + Intergenic
1155429853 18:25743883-25743905 GAACTTCAGCAACTGCAGCCAGG + Intergenic
1158961233 18:62589147-62589169 GAAATTTAGCAACTAGACAGAGG - Intergenic
1163871885 19:19828623-19828645 AAACTTTAGCAACTGGACCGAGG - Intergenic
1164028652 19:21380054-21380076 GAACTTTAGCAACTGGACTGAGG + Intergenic
1166874296 19:45887844-45887866 GAAGTTTAGAAACTGGCCCAAGG - Intergenic
927958126 2:27222719-27222741 GACTTTTAGCAATTGGACCAAGG - Intronic
928347881 2:30517541-30517563 GTACTTTAACAACTGGAACTGGG + Intronic
928476235 2:31630214-31630236 GTACTTTAACAACTGGAACTGGG + Intergenic
930631352 2:53757927-53757949 GTACTTTAACAACTGGAACTGGG + Intronic
931514492 2:63038722-63038744 GAACTTTTGCAACTTGCCCAGGG + Exonic
934141272 2:89050204-89050226 GAAATCTGGCCACTGGACCGAGG + Intergenic
934227969 2:90150340-90150362 GAAATCTGGCCACTGGACCGAGG - Intergenic
936387523 2:112043634-112043656 GTACTTTAACAACTGGAACTGGG - Intergenic
938103999 2:128517641-128517663 GAACTTTAGCAACTGGACCAAGG + Intergenic
940368456 2:152875039-152875061 GAAGTTTAGCAACCTGACCAAGG + Intergenic
943337055 2:186628538-186628560 GAAATTAAGTAACTTGACCGTGG + Intronic
945035844 2:205703456-205703478 GAAGTTAAGCAACTGGCCCAAGG + Intronic
947393063 2:229659474-229659496 GAACTGTAGGACCTGGACCCGGG + Intronic
1169621889 20:7516360-7516382 CAACTTTAGCAGCTGGTCTGAGG - Intergenic
1179292691 21:40032381-40032403 GAACTTTAAAAACTACACCGAGG - Intronic
950442668 3:13019106-13019128 GAGGTTTAGCAACTTGCCCGAGG + Intronic
955751509 3:62189230-62189252 GAACCTTACCAACTGAACTGGGG + Intronic
956324911 3:68041522-68041544 GAAGTTTAGAAACTGAACCTGGG + Intronic
959374956 3:105577927-105577949 GAACTTCAGCAACTTGAGCATGG - Intergenic
961621229 3:128226593-128226615 GGAATTTAGCAACTGGAGGGAGG - Intronic
964128682 3:153263902-153263924 GAACTCTAGCCACTGGGCTGGGG + Intergenic
965474403 3:169137166-169137188 GAACTTCAGCAATTGGAGGGTGG + Intronic
968391411 4:196111-196133 GTACTTTAACAACTGGAACTGGG - Intergenic
969470048 4:7382259-7382281 GAACTTTAGCATCTGGGCAGTGG + Intronic
972179354 4:36444241-36444263 GTACTTTACCAACTGGAACTGGG + Intergenic
974520160 4:62972615-62972637 GTACTTTAACAACTGGAACTGGG + Intergenic
976189555 4:82475180-82475202 GTACTTTAACAACTGGAACTGGG + Intergenic
977618247 4:99108705-99108727 GTACTTTAACAACTGGAACTGGG - Intergenic
980444019 4:132883636-132883658 GTACTTTAACAACTGGAACTGGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991099358 5:62775727-62775749 GAACTTTAGCAACTGGACCGAGG + Intergenic
992293680 5:75305670-75305692 GTACTTTAACAACTGGAACTGGG + Intergenic
994032296 5:95157517-95157539 AAACTTTAGCAACTTGTCCATGG + Intronic
994187851 5:96835780-96835802 AAACTTTATCAACTGGAGCAGGG + Intronic
999997241 5:157103777-157103799 GAATTTGAGCAACTTGACTGAGG + Intronic
1002824005 6:756134-756156 TAACTTTAGCAACAGATCCGTGG - Intergenic
1005847311 6:29792169-29792191 GAACTTTAGAACCGGGACCGCGG - Intergenic
1005851669 6:29827782-29827804 GGACTTTAGAACCAGGACCGCGG - Exonic
1005859047 6:29887687-29887709 GGACTTTAGAACCGGGACCGCGG - Intergenic
1007332168 6:41120683-41120705 GAGCTTCAGCAGCTGGACCAGGG - Intergenic
1013959345 6:115880327-115880349 GAGGTTAAGCAACTGGACCAAGG + Intergenic
1016343474 6:143086468-143086490 GTACTTTAACAACTGGAACTGGG - Intronic
1020739844 7:12000834-12000856 GAAGTGCAGCAACTGGACAGAGG + Intergenic
1021278804 7:18690609-18690631 GTACTTTAGCAATTTGACCCTGG - Intronic
1023439570 7:40172152-40172174 GTACTTTAACAACTGGAACTGGG - Intronic
1026179417 7:68025558-68025580 GAACTTCAGCTCCTGGACAGAGG - Intergenic
1027726111 7:81808024-81808046 TACCTTTAGCAAGTGGACAGTGG - Intergenic
1028723714 7:94062788-94062810 GACCCTTAGCAACTGGTCTGTGG - Intergenic
1032725522 7:134586917-134586939 GTACTTTAACAACTGGAACTGGG + Intergenic
1034846923 7:154454888-154454910 AAACTTTAACACCTGGACCTTGG - Intronic
1035579940 8:733151-733173 GAACTTTAGAAAGTGGTCCAAGG + Intronic
1042055882 8:64764314-64764336 GTACTTTAACAACTGGAACTGGG + Intronic
1043550403 8:81365434-81365456 GAATTTAAGCAACTGGGCCAAGG + Intergenic
1045325666 8:101115996-101116018 CAACTATAGCAACTGGGTCGGGG + Intergenic
1046443252 8:114284272-114284294 GAAATCTGGCAACTGGACCAAGG + Intergenic
1046862198 8:119106044-119106066 GAACTATAGCAACTGGAATGAGG + Exonic
1050696742 9:8287703-8287725 GAACTTCAGGAAATGGACCCTGG - Intergenic
1055663485 9:78530783-78530805 GAACCCTATCAACCGGACCGTGG - Intergenic
1056404975 9:86264900-86264922 GAACTTTAGCAACTGGACCGAGG + Exonic
1185808848 X:3086336-3086358 GAACTTTTGAAACTCGACAGAGG - Intronic
1187677266 X:21728764-21728786 GAGCTTATGCAACTTGACCGAGG - Intronic
1191167304 X:57404464-57404486 GTACTTTAACAACTGGAACTGGG - Intronic
1193172192 X:78349273-78349295 GTACTTTAACAACTGGAACTGGG - Intergenic
1193247299 X:79244143-79244165 GAACTTTAGCCCCTGGTCGGGGG - Intergenic