ID: 1056405053

View in Genome Browser
Species Human (GRCh38)
Location 9:86265637-86265659
Sequence GACTGCTGGTAGTAATATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 2, 1: 5, 2: 1, 3: 7, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056405053_1056405058 16 Left 1056405053 9:86265637-86265659 CCACCATATTACTACCAGCAGTC 0: 2
1: 5
2: 1
3: 7
4: 75
Right 1056405058 9:86265676-86265698 GATTTTAGGAGTCACCGATCTGG 0: 1
1: 1
2: 2
3: 4
4: 44
1056405053_1056405059 20 Left 1056405053 9:86265637-86265659 CCACCATATTACTACCAGCAGTC 0: 2
1: 5
2: 1
3: 7
4: 75
Right 1056405059 9:86265680-86265702 TTAGGAGTCACCGATCTGGTTGG 0: 1
1: 2
2: 2
3: 6
4: 55
1056405053_1056405060 21 Left 1056405053 9:86265637-86265659 CCACCATATTACTACCAGCAGTC 0: 2
1: 5
2: 1
3: 7
4: 75
Right 1056405060 9:86265681-86265703 TAGGAGTCACCGATCTGGTTGGG 0: 1
1: 2
2: 3
3: 6
4: 49
1056405053_1056405056 2 Left 1056405053 9:86265637-86265659 CCACCATATTACTACCAGCAGTC 0: 2
1: 5
2: 1
3: 7
4: 75
Right 1056405056 9:86265662-86265684 GATGTCCTGTCTCAGATTTTAGG 0: 1
1: 1
2: 4
3: 12
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056405053 Original CRISPR GACTGCTGGTAGTAATATGG TGG (reversed) Exonic
904994618 1:34621607-34621629 GACTCCTGGAAGTAATATTGGGG - Intergenic
909941155 1:81613480-81613502 GCGTGCTGTTAGTAATAAGGTGG + Intronic
911879359 1:103215471-103215493 GAGTGATGGTAGTAATATCTGGG + Intergenic
912397872 1:109361162-109361184 GACTGCTCGTAGTAAAATGTGGG - Intronic
912580769 1:110719053-110719075 GTCTGCTGGAAATAATAGGGTGG + Intergenic
916847604 1:168669122-168669144 GACTACTGGTAGGAATATAAAGG + Intergenic
920567758 1:206989171-206989193 GACTGCTGGTACTAAATTTGGGG - Intergenic
920951066 1:210572286-210572308 GACTGCTGGTGGTAATGAGGAGG - Intronic
921338919 1:214114875-214114897 GAAAGCTGGTAGTAACCTGGAGG + Intergenic
922747261 1:228051284-228051306 GACAGCTGGCAGTAATTTAGGGG + Intronic
924066343 1:240226322-240226344 GTCTGCTGTTAGTATTATTGGGG - Intronic
1072136179 10:92548621-92548643 GAATGCTGGTAATAACATGGTGG - Intronic
1073587742 10:104726827-104726849 GACTGCTGGTCCTATTCTGGGGG - Intronic
1073758899 10:106609762-106609784 GACAGCTGGTAGAAAGGTGGAGG + Intronic
1078370310 11:10739165-10739187 GAGTGCTGGCAGGAATATGAGGG + Intergenic
1078971554 11:16418589-16418611 GAATGCTGTTAGGAATATGTGGG - Intronic
1079417659 11:20254536-20254558 GACTGATGGTAGAAATGTTGAGG - Intergenic
1080023153 11:27585353-27585375 GACTTCTGGTTTTAAAATGGTGG - Intergenic
1085816305 11:79741049-79741071 GACTGCTGGGAGTCATAAAGAGG - Intergenic
1091228646 11:133973552-133973574 GAATGCTGGGAGTGAAATGGTGG - Intergenic
1093571091 12:20666722-20666744 GACTGCTGCAATAAATATGGGGG + Intronic
1097607471 12:61773311-61773333 GAATGCTGGTGGTAATTTGATGG - Intronic
1100428143 12:94506758-94506780 GACTGCTGGATGTATCATGGGGG - Intergenic
1104332926 12:127864459-127864481 GAATGATGGTAGTATTTTGGTGG - Intergenic
1111090611 13:83441167-83441189 GATTGCTGGTAGAAATATGGAGG - Intergenic
1117693485 14:58334880-58334902 GACTGGTGGAGGAAATATGGAGG - Intronic
1121317234 14:92969561-92969583 GTCTGCTGGTACTGAGATGGTGG - Intronic
1124242153 15:28037570-28037592 AAATCCTGGTAATAATATGGTGG - Intronic
1125607315 15:40948061-40948083 GACTGCTGGTAGTAACATGGTGG - Intergenic
1127344776 15:58083456-58083478 GACACCTGGTTGAAATATGGTGG + Intronic
1131029874 15:89177622-89177644 GATTCCTGGTAGGAAGATGGGGG - Intronic
1135381946 16:22003026-22003048 CCCTGCTGGTAGGAAGATGGAGG - Intergenic
1142051297 16:87959861-87959883 GACTCCTGGTAGTATTCTTGGGG + Intronic
1149226592 17:54478581-54478603 GACTGCTGGTAGTAACATGGCGG + Intergenic
1156664307 18:39386695-39386717 GAGTGCTGGAAGTAAGAGGGTGG - Intergenic
1160056755 18:75489758-75489780 GACAGCTGGTAAGAAAATGGGGG + Intergenic
1163871800 19:19827888-19827910 GACTGCTGGTAGTAACATGGTGG + Intergenic
1164028741 19:21380789-21380811 GACTGCTGGTAGTAACATGGTGG - Intergenic
926884075 2:17580934-17580956 AACTGCTGGTGGTATAATGGTGG - Intronic
927010717 2:18900844-18900866 GACTGCTGGTGGTGATGTTGGGG + Intergenic
929229746 2:39547328-39547350 GGATGCTGGGACTAATATGGAGG + Intergenic
929265498 2:39914461-39914483 TACTGCTAGTAGCAATGTGGTGG - Intergenic
933168905 2:79103601-79103623 GACTGCTGGAGGGAATATGATGG - Intergenic
935895605 2:107734156-107734178 GAGGGCTGGTAATACTATGGTGG + Intergenic
938104084 2:128518381-128518403 GACTGCTGGTAGTAATGTGGCGG - Intergenic
939646183 2:144701802-144701824 GACTGTTGGTTGTTATAGGGTGG + Intergenic
940761695 2:157745628-157745650 GACTGGGGGCAGGAATATGGAGG - Intronic
947457790 2:230271471-230271493 GACTGTTAGTAAAAATATGGAGG + Intronic
948243907 2:236462143-236462165 GGCTGATGGTAGCAAAATGGAGG + Intronic
1176161035 20:63648915-63648937 GACGGCTGGCAGCAATTTGGGGG + Intronic
1178677015 21:34639522-34639544 TAGTGCTGGGAGTAACATGGTGG - Intergenic
1180635665 22:17261238-17261260 GGCTACTGGAAGAAATATGGTGG + Intergenic
950922334 3:16707236-16707258 GACTGCTGGAAGTCAAATGTTGG - Intergenic
950965147 3:17140901-17140923 GGGTGCGGGTAGTAATCTGGCGG + Intergenic
952099120 3:29991184-29991206 GACTGTTGGTAAGAATATGCAGG - Exonic
955437218 3:58914733-58914755 GAATGCTGATTTTAATATGGAGG + Intronic
963672458 3:148269251-148269273 GAATGGTGGTAGAAATATGGAGG - Intergenic
964537064 3:157734681-157734703 GACTTCTGGTCCTAAAATGGTGG + Intergenic
964585885 3:158301343-158301365 GAATGCTGGCTGTAACATGGAGG - Intronic
966400818 3:179545446-179545468 CACTGCTGGAAGGAAGATGGGGG - Intergenic
970147444 4:13051823-13051845 GACTGCTGGAAGTAATTTAGAGG + Intergenic
971557923 4:28037499-28037521 AAATGCTGATAGTGATATGGAGG - Intergenic
979480653 4:121213192-121213214 GCCTTCTGGTAATGATATGGTGG - Intronic
984906646 4:184633697-184633719 GACTGCTGGTCTAAATATGTGGG + Intronic
988302674 5:29451121-29451143 GACTGTTGCTAGAAATAAGGAGG - Intergenic
989485610 5:41988088-41988110 CACGGCTTTTAGTAATATGGTGG + Intergenic
990441488 5:55850337-55850359 TACTGCTGGTAGTCAGATGTTGG + Intergenic
991099443 5:62776469-62776491 GACTGCTGGTAGTAATATGGTGG - Intergenic
992041393 5:72836730-72836752 GACTGCTTATAGTAAGATGCAGG - Intronic
993598813 5:89893715-89893737 ATCTGCTGATAGTATTATGGAGG - Intergenic
998924071 5:147103236-147103258 TAATAGTGGTAGTAATATGGTGG - Intergenic
1001215050 5:169848311-169848333 CACTGCTGGTAGGAATAAGCAGG + Intronic
1004172401 6:13305959-13305981 GCCTGCTGATAGTCACATGGAGG + Intronic
1013571149 6:111427418-111427440 GACTTCTGGTTGTAAAACGGTGG + Intronic
1020182617 7:5934156-5934178 GGCTGGAGGTAGAAATATGGGGG - Intronic
1020300294 7:6790601-6790623 GGCTGGAGGTAGAAATATGGGGG + Intronic
1021516778 7:21498100-21498122 GAGGGCTGGTTGTAATAAGGGGG - Intronic
1022818056 7:33932287-33932309 GACTGCTGGGAATAAAGTGGCGG - Intronic
1030502760 7:110380715-110380737 CACTGCTCTTAGTGATATGGAGG + Intergenic
1030533084 7:110734478-110734500 GACTGCTTATAGTAAAATGCAGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1040682221 8:49825991-49826013 GACTGATGGTAGGAATAAGCTGG - Intergenic
1043843357 8:85135349-85135371 GATTGCTGGTATTAATTTTGTGG + Intronic
1051543438 9:18247615-18247637 GAATGCTGGTCTTAATCTGGTGG + Intergenic
1056405053 9:86265637-86265659 GACTGCTGGTAGTAATATGGTGG - Exonic
1187219892 X:17314051-17314073 GTCTGCTGATAGTCTTATGGAGG - Intergenic
1188553928 X:31390683-31390705 GACTACTGGGAGTAAGATGGCGG - Intronic
1188970811 X:36613259-36613281 TACTGCAGGTAGGATTATGGAGG - Intergenic
1194858259 X:98961275-98961297 GACTATTGGTAGTTATATGTAGG - Intergenic
1198314203 X:135450373-135450395 GACTGCAGGTACTCATGTGGTGG - Intergenic