ID: 1056405644

View in Genome Browser
Species Human (GRCh38)
Location 9:86271822-86271844
Sequence TACACAATGCTGAATGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056405644 Original CRISPR TACACAATGCTGAATGTGGG TGG (reversed) Intronic
901622707 1:10601545-10601567 CACAGAAGGCTGAATGGGGGAGG + Intronic
902904686 1:19547285-19547307 GACACAATGCTGAAGGTTGTGGG + Intergenic
905568683 1:38986969-38986991 TCCACATTGCTGAGTGTGGGTGG - Intergenic
906344806 1:45008478-45008500 CACACAAGGCTCAATGTTGGGGG + Intronic
908090134 1:60677202-60677224 TACAAGATGCTGGATGTAGGAGG - Intergenic
910718968 1:90264307-90264329 GACAGAAGGCTGAATGTGGGTGG + Intergenic
910898755 1:92096452-92096474 TTCACACAGCTGAATGTGGCTGG + Intronic
912259767 1:108098822-108098844 TACAAAATCCTAAATATGGGTGG + Intergenic
912688562 1:111786337-111786359 TACACACTGCTGAAAATGGCAGG - Intronic
919420981 1:197370012-197370034 TACAAAATTCTGAATGAGGATGG - Intronic
1063900025 10:10723024-10723046 TACATAATGATGGATGAGGGAGG - Intergenic
1067527389 10:47046840-47046862 TACAGAACCCTGAGTGTGGGCGG + Intergenic
1068096446 10:52497999-52498021 AACATAATGCTGAATGGGGAAGG - Intergenic
1070437402 10:76406659-76406681 TACACAAGGCTGATTCAGGGTGG + Intronic
1071953267 10:90728891-90728913 TACAGAATTCTGAAAGTGGGAGG + Intergenic
1072628987 10:97132657-97132679 TACACAATGAAAAATGGGGGTGG - Intronic
1072942449 10:99778619-99778641 TACAGAATGCTGGCTGTTGGTGG + Intergenic
1075615109 10:123885086-123885108 GGCACAGTGCTGTATGTGGGAGG + Intronic
1075762796 10:124869674-124869696 CACAGACTGGTGAATGTGGGTGG + Intergenic
1076242336 10:128917750-128917772 TACACAGGTCTGAGTGTGGGAGG - Intergenic
1078968196 11:16372023-16372045 TATAAAATGTTGAATTTGGGAGG - Intronic
1083362722 11:62122341-62122363 CACACACTGCCAAATGTGGGGGG + Intergenic
1088439262 11:109850495-109850517 AAAACAATGCTGTATGTGGATGG + Intergenic
1090396642 11:126423779-126423801 TACACAAAGCAGGAGGTGGGTGG + Exonic
1091109819 11:132955585-132955607 TAGAAAATGCTGAATCTGGCTGG + Intronic
1091654313 12:2334177-2334199 TACACAAGGCAGAAAGTGGGTGG + Intronic
1093289945 12:17307812-17307834 TACAGAATTCAGAATCTGGGTGG - Intergenic
1097458402 12:59830502-59830524 TACAAAATACTCAATGGGGGGGG - Intergenic
1101760976 12:107658726-107658748 TAGATGATGCTGAATGGGGGAGG + Exonic
1101959301 12:109236661-109236683 TGCAAAATGCTGAATTTGGTGGG - Intronic
1101989069 12:109469613-109469635 TACGTGAAGCTGAATGTGGGTGG - Exonic
1103533618 12:121619849-121619871 TACAAAATGCAGAATGGGGTCGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104265355 12:127227166-127227188 TACAAAGTCCTGAATGGGGGAGG + Intergenic
1109907135 13:68858245-68858267 TACATAATAATGAATCTGGGTGG - Intergenic
1110151573 13:72260950-72260972 TACAGAATTTTGAATGAGGGAGG - Intergenic
1113281219 13:108789986-108790008 TACACTAAGCTGAAGGTGAGGGG + Intronic
1114230772 14:20780315-20780337 TACACAATTCTGTCTTTGGGAGG + Intergenic
1118079419 14:62341147-62341169 TACACATTGCTAAATATGTGAGG - Intergenic
1121628128 14:95401749-95401771 TTCATGATGCTGAGTGTGGGAGG + Intergenic
1123874990 15:24614974-24614996 TACACAATCCTGAAGGAGGCAGG + Intergenic
1126333935 15:47565585-47565607 TGTACAATTCTGAATCTGGGAGG + Intronic
1126463602 15:48939620-48939642 TACACTATGCTGAATGTCTGAGG + Intronic
1129510198 15:76116009-76116031 TAAAGAACACTGAATGTGGGGGG - Intronic
1130810252 15:87369059-87369081 TACAGAATTCCGAATGTGGATGG + Intergenic
1135012700 16:18896204-18896226 TACACATTGCTGTTTGTAGGTGG - Exonic
1136329845 16:29565503-29565525 TACACATTGCTGTTTGTAGGTGG - Intergenic
1136444474 16:30305207-30305229 TACACATTGCTGTTTGTAGGTGG - Intergenic
1138315000 16:56062363-56062385 GACTGAATTCTGAATGTGGGTGG - Intergenic
1140743050 16:77958516-77958538 TCCACAGTGCTGGATTTGGGTGG - Intronic
1141207616 16:81945561-81945583 TAAACATTACTGAATGGGGGTGG + Intronic
1141313376 16:82936572-82936594 TTAAAAATGCTGAAGGTGGGGGG - Intronic
1142190268 16:88714202-88714224 TACACAGTGCTGACAGTGGAGGG - Exonic
1150497903 17:65623220-65623242 TCCTCAATGGTGAAGGTGGGTGG + Intronic
1150979774 17:70127859-70127881 AACACAATTCTGAATGTCTGTGG - Intronic
1151356797 17:73563468-73563490 CTCAGAAGGCTGAATGTGGGAGG + Intronic
1151924532 17:77184979-77185001 TACACAATTCTAACTGTGGAGGG - Intronic
1154026528 18:10712593-10712615 TTCAAAATGTTGATTGTGGGAGG + Intronic
1157508809 18:48252794-48252816 GCCAGAATGCTGAAAGTGGGAGG + Intronic
1158109865 18:53929096-53929118 GACAGAATGCTGGCTGTGGGAGG - Intergenic
1158861748 18:61599099-61599121 TACACACTTATTAATGTGGGAGG - Intergenic
1159991842 18:74917938-74917960 TAAACAATGGTGAATTTAGGAGG + Intronic
1161674313 19:5635624-5635646 TACCCAGGGCTGCATGTGGGTGG - Intronic
1165638677 19:37365215-37365237 TACACACTTCTCAAAGTGGGTGG + Intronic
926935684 2:18084936-18084958 TACAAACAGCTGAATGGGGGTGG - Intronic
928288488 2:30015547-30015569 AACATAATGTTGAATGGGGGAGG + Intergenic
930167705 2:48219567-48219589 CACACAATGCTGGTTGTTGGAGG - Intergenic
930998663 2:57754509-57754531 AACACAATGCAGAATATGTGTGG + Intergenic
932621525 2:73267211-73267233 TACACAAACATGAATGTGTGAGG - Intronic
935841065 2:107110931-107110953 TTCACAATGCAGAAGGTAGGCGG - Intergenic
940138982 2:150472687-150472709 TACATATTTGTGAATGTGGGTGG - Intronic
946045058 2:216814090-216814112 TACTCAATCCTGAAGGTGGAAGG - Intergenic
947129024 2:226902742-226902764 TGGAAAATGCTGAATGTTGGAGG + Intronic
948120685 2:235528209-235528231 TGCAAAGTCCTGAATGTGGGGGG - Intronic
948894020 2:240919919-240919941 GGCACAAGGCTGAGTGTGGGTGG + Intronic
1168983945 20:2031581-2031603 CACAAAATGCTCAGTGTGGGTGG - Intergenic
1170456489 20:16538219-16538241 CACTCAGTGCTGATTGTGGGTGG - Intronic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1172300706 20:33848044-33848066 TACACACTGATGAATGTGCCAGG + Intronic
1172783843 20:37452966-37452988 GACACATTGCTGAATGAGGAAGG - Intergenic
1176700762 21:10047173-10047195 AACACTATGCTGAATATGAGTGG - Intergenic
951249643 3:20380059-20380081 AACACTATGTGGAATGTGGGGGG + Intergenic
952436759 3:33279017-33279039 TTCACAATAGTGAATGAGGGTGG - Intronic
955463720 3:59214094-59214116 TACAGAATGCTGAATAGGGATGG - Intergenic
957496587 3:80999475-80999497 TTGACAATGCTTAATGTGGAGGG + Intergenic
959299386 3:104578560-104578582 TACACAGTGCTAAATGTCAGTGG + Intergenic
964753763 3:160076461-160076483 TACACACTGGTGGATATGGGTGG - Intergenic
965887692 3:173468508-173468530 TACACAAATCTGAATGAGTGAGG + Intronic
966192515 3:177284309-177284331 TACAGAAGGCTGAAAGTGGATGG + Intergenic
972263776 4:37439213-37439235 TACATAATGATGAATGTTGAAGG - Exonic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973626607 4:52778798-52778820 TCCCCAATGCTGGAGGTGGGAGG - Intergenic
974185851 4:58445268-58445290 TACATAAAGCTGTATGTGAGAGG + Intergenic
974965884 4:68760270-68760292 GAGAAAATGCTGAATGTGGATGG - Intergenic
976264646 4:83178955-83178977 TACAGAATGTTGAATTTGGGTGG + Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
978065545 4:104395317-104395339 TAGACAGTAATGAATGTGGGTGG + Intergenic
978451333 4:108837253-108837275 TACACAATTTGAAATGTGGGAGG - Intronic
982236167 4:153253074-153253096 TACTCAATCCAGACTGTGGGTGG + Intronic
982670506 4:158314386-158314408 GACAAAATGCTGAATGTGGATGG - Intergenic
983730920 4:170992136-170992158 GAGAAAATGCTGAATGTGGATGG - Intergenic
985365391 4:189226559-189226581 TATTCAATGCTGGAAGTGGGAGG - Intergenic
988238280 5:28575176-28575198 GAGAAAATGCTGAATGTGGATGG + Intergenic
988934574 5:36069069-36069091 TAAACAAGGTTAAATGTGGGTGG + Intronic
988936791 5:36091550-36091572 TCCCCAATGCTGGAGGTGGGAGG + Intergenic
992572842 5:78077419-78077441 TAAACAATGCTGAAGGAGGTTGG - Intronic
993032396 5:82720480-82720502 TGCAGAATGAGGAATGTGGGTGG + Intergenic
994890750 5:105631696-105631718 TACACAATAATTAATATGGGAGG - Intergenic
996612897 5:125405044-125405066 GACACAAGGCTGTTTGTGGGAGG - Intergenic
998629394 5:143881627-143881649 GTCACAGTGCTGAATGTGAGGGG - Intergenic
1001092582 5:168752199-168752221 GTCACAGTGCTGAATGAGGGAGG - Intronic
1001414370 5:171534293-171534315 TACTGAATGCTCAACGTGGGAGG - Intergenic
1009034235 6:58097287-58097309 GACAAAATGCTGAATGTGGATGG + Intergenic
1009209843 6:60848988-60849010 GACAAAATGCTGAATGTGGATGG + Intergenic
1010336575 6:74691403-74691425 TGCAGAGTGCTGAATGTGGAAGG - Intergenic
1015459620 6:133474070-133474092 TTCTCAATGATGAATGTGTGAGG + Intronic
1015599753 6:134900826-134900848 TGCAGAATGCAGAATGTAGGGGG + Intergenic
1017679034 6:156845259-156845281 TACAGAATGCAGAATGCGGCAGG - Intronic
1018490626 6:164288933-164288955 TACACACTCCTGGATGTGTGTGG + Intergenic
1018659765 6:166075340-166075362 AAGAAAATGCTGAATGTGGCAGG + Intergenic
1020161717 7:5778204-5778226 TACTGAATGGTGAATGCGGGGGG - Intronic
1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG + Intronic
1028309772 7:89316909-89316931 TGCAGAATCCAGAATGTGGGAGG - Intronic
1028674076 7:93438511-93438533 TACAAATTGCTGAATGTAGCAGG + Intronic
1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG + Intergenic
1030932745 7:115545202-115545224 TACACAATGCAAAATTTGGGAGG + Intergenic
1032227421 7:130043910-130043932 TTCACAGTGTTGAATATGGGAGG + Intronic
1035108574 7:156462072-156462094 TACACCATGCTTACTCTGGGGGG + Intergenic
1038112280 8:24513027-24513049 TACACAGTTCTGAATTTTGGGGG - Intronic
1039214473 8:35254076-35254098 AGCACAAGGCTGAATGTGAGAGG - Intronic
1039382698 8:37100682-37100704 TAAACAATTCAGAATGTGGAAGG + Intergenic
1042123405 8:65512298-65512320 AACACAATGAGGAAGGTGGGAGG + Intergenic
1042697667 8:71574315-71574337 GACACAATGCTGAATAGAGGTGG + Intronic
1044421466 8:92000703-92000725 TAGAAAATGCTGAAGGTTGGAGG - Intronic
1046420676 8:113979918-113979940 GAGAAAATGCTGAATGTGGATGG + Intergenic
1046806487 8:118484970-118484992 TACCCAATGATGCTTGTGGGTGG + Intronic
1048227743 8:132605692-132605714 TACAGAATGCTGAGGTTGGGAGG + Intronic
1048786961 8:138060841-138060863 GACAAAAGGCTGAATGTGGGGGG + Intergenic
1050135722 9:2461640-2461662 TACATAATCCTGAATGTGACGGG + Intergenic
1055756726 9:79566231-79566253 GACACAGTGGTGTATGTGGGAGG - Intergenic
1056405644 9:86271822-86271844 TACACAATGCTGAATGTGGGTGG - Intronic
1058817425 9:108697717-108697739 AACACACTGCTGATTGTTGGGGG - Intergenic
1060721574 9:125983159-125983181 TACACAATGCCTAGAGTGGGTGG + Intergenic
1062715033 9:138005623-138005645 AACACAATGCTAAATGTTTGAGG + Intronic
1186273498 X:7915893-7915915 TTCACAAGGCTAAATGTGAGAGG + Intronic
1188946889 X:36316302-36316324 AACACAATTCTTAATGTGGTTGG - Intronic
1189337255 X:40177251-40177273 TAGACAAGGCTGCATGTGCGGGG - Intronic
1190604154 X:52123262-52123284 AACACAATGTTGAATAGGGGTGG - Intergenic
1191854101 X:65608807-65608829 TATACAACCCTGTATGTGGGTGG - Intronic
1193487791 X:82107954-82107976 AACACAATCATGAGTGTGGGTGG - Intergenic
1195143697 X:101990660-101990682 TATACATTGCTCAATGAGGGGGG + Intergenic
1196872864 X:120129163-120129185 TACTTACTGCTGAAAGTGGGAGG + Intergenic
1201531509 Y:14994413-14994435 TCCACAATGGTGGATATGGGTGG - Intergenic