ID: 1056405760

View in Genome Browser
Species Human (GRCh38)
Location 9:86273269-86273291
Sequence TGTACATTGTTAGTTGCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056405760_1056405763 23 Left 1056405760 9:86273269-86273291 CCATCGGCAACTAACAATGTACA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1056405763 9:86273315-86273337 AACTCAACAATTCTGTATCTAGG No data
1056405760_1056405764 28 Left 1056405760 9:86273269-86273291 CCATCGGCAACTAACAATGTACA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1056405764 9:86273320-86273342 AACAATTCTGTATCTAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056405760 Original CRISPR TGTACATTGTTAGTTGCCGA TGG (reversed) Intronic
916183333 1:162106768-162106790 CGTACATTGTTATTTGCTGGGGG + Intronic
916324282 1:163539975-163539997 TATACAATGTTAGGTGCTGATGG + Intergenic
917732473 1:177889999-177890021 ATTACATTGTTAGTTACAGATGG - Intergenic
924422535 1:243923108-243923130 TGTAGAATGGTGGTTGCCGAGGG - Intergenic
1074216730 10:111392355-111392377 TGTACATTGTTAATTGGCCAGGG + Intergenic
1081083460 11:38771165-38771187 AGTAGATTGTTAGTTGTCTAGGG - Intergenic
1083193502 11:61069096-61069118 TGTTCATTGTCAGTTGCCCCAGG + Intergenic
1085896547 11:80646907-80646929 TGTACATTATCAGTTCCCCAAGG + Intergenic
1097791153 12:63817011-63817033 TGTTCATTGTGAGTTGCTGGGGG - Intergenic
1099889008 12:88566629-88566651 TGTACATAGTTAGGTGACGCTGG + Intronic
1110582796 13:77151874-77151896 TGTACATTTGTGGTTGCCTAGGG - Intronic
1111599953 13:90460358-90460380 TGTACATGGGTGGTTGCAGAAGG - Intergenic
1115957893 14:38801791-38801813 TCTACAGTGTTAGTTGGCTAGGG - Intergenic
1118854117 14:69608129-69608151 AGTAGATTGTTGGTTGCCTAGGG + Intergenic
1119273695 14:73332779-73332801 TGCAGATTGGTAGTTGCCGGGGG - Intronic
1120191317 14:81442561-81442583 TGGATATTGTTGGTTGCTGAAGG + Intergenic
1121341707 14:93109067-93109089 TGTACATTGCTAGATGAGGAGGG - Intronic
1125990241 15:44099654-44099676 TGGAGATTGTTTGTTGCCAAGGG + Intronic
1133672385 16:8035512-8035534 TGTACATTTTTAATTGTGGAAGG - Intergenic
1133836333 16:9370726-9370748 TGCACATTGCTAGTTGCCATTGG - Intergenic
1139118042 16:63980547-63980569 TGACCATTTTTAGTTGCTGAAGG + Intergenic
1145828092 17:27892613-27892635 AGTACATTGGTGGTTGCCTAGGG + Intronic
1150166560 17:62949616-62949638 TGTACATTAGTAGTTGCCTAGGG + Intergenic
1150932850 17:69603970-69603992 TGTACTGTGTTAGTTTCCCAGGG + Intergenic
1154041068 18:10856660-10856682 TGCACATTGTTAATTGCAGCAGG + Intronic
1155656804 18:28202203-28202225 TGAACATTGTTATTTGCTGTCGG - Intergenic
1158237601 18:55336378-55336400 TGCACATGGTTAGTAGCTGATGG - Intronic
1161842438 19:6690904-6690926 TGTACATTGACATTTGCAGAAGG - Intronic
927740218 2:25562077-25562099 TGTACATTAGTAGTTTCCGGGGG - Intronic
929307126 2:40376219-40376241 TGTACATTGTTAGATGCTTAAGG - Intronic
934906742 2:98211485-98211507 TGTACATTGTTAGATTGCTAAGG + Intronic
941001971 2:160211397-160211419 TGCACATTGTGAGTTTCTGATGG - Intronic
942127796 2:172844969-172844991 TGTATATAGTAAGTTGCCCAAGG - Intronic
942762907 2:179420845-179420867 AGTAGAATGTTAGTTGCCCAGGG - Intergenic
945686597 2:212978318-212978340 TGAAAATTCTTAGTTGCCTATGG - Intergenic
946382249 2:219356994-219357016 AGTACATTGGTGGTTGCCTAGGG + Intergenic
947689414 2:232120962-232120984 TGGACATGGTTAATTGCTGATGG - Intronic
1170074911 20:12409021-12409043 TGTACATTGTTCATTGAGGAAGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172891032 20:38264378-38264400 TGCACATTGTTGGTTGCATATGG - Intronic
1182204329 22:28608577-28608599 TGCACATTTTTAGATTCCGAGGG - Intronic
1185044008 22:48519939-48519961 TGGAAATTGTTTGTTGCAGATGG + Intronic
953501155 3:43435852-43435874 TATTCATTGTTATTTGCCTAGGG - Intronic
954118448 3:48480264-48480286 TGTACCTTCTTAGTTTCCCAAGG - Intronic
957188912 3:76980856-76980878 TGTAGATGATTAGTTGCCTAAGG - Intronic
961606932 3:128102650-128102672 AGTAGATTAGTAGTTGCCGAGGG + Intronic
966089954 3:176121578-176121600 TGTAGATTGGTAGTTGTCTAGGG - Intergenic
966968082 3:185016041-185016063 CGTCTTTTGTTAGTTGCCGAGGG + Intronic
970814312 4:20136143-20136165 AGTAGATTGTTGGTTGCCTATGG + Intergenic
973785548 4:54329375-54329397 AGTAGATTATTAGTTGCCTAGGG - Intergenic
981099832 4:140817747-140817769 GGTACATTGTCAGTAGCCTATGG - Intergenic
984956167 4:185047952-185047974 TCTCCTTTGTTAATTGCCGAGGG + Intergenic
986807529 5:11322767-11322789 TGTGCTTTGTTACCTGCCGAAGG - Intronic
986862472 5:11943551-11943573 AGTAGATTGTTGGTTGCCTATGG + Intergenic
991720450 5:69490873-69490895 AGTACATTAGTGGTTGCCGAGGG + Intergenic
994629139 5:102260963-102260985 TTTACATTGTTATTTGCAGCAGG - Intronic
995085681 5:108106716-108106738 AGTAGATTGGTAGTTGCCAAGGG + Intronic
1001340532 5:170839620-170839642 TGTACAGAGTTAGTTGTCCAGGG + Intergenic
1002139579 5:177130993-177131015 TGTGCATTGGAAGTTGCAGATGG + Intergenic
1004338829 6:14789086-14789108 TGTACATTGTAAGTTCCAAAAGG - Intergenic
1004853184 6:19721953-19721975 TGTACATTGTATATTGCAGATGG - Intergenic
1009861395 6:69338521-69338543 TGTTCATTGTTAATTGCAGAAGG - Intronic
1011098932 6:83700031-83700053 TGTACATTATTATTTGATGAAGG - Intronic
1023902094 7:44489775-44489797 TTTACACTCTTAGTTGCCGCAGG - Intronic
1030870923 7:114755471-114755493 TGTACTTTGCTATTTGCCCATGG + Intergenic
1031772905 7:125868255-125868277 TGTAGATTGTAAGCTGCCTAAGG - Intergenic
1033205023 7:139412191-139412213 TTTACATTTTTTGTTGCCTAGGG - Intronic
1033448644 7:141443274-141443296 TGTACATTATTATTAGCCAACGG + Intronic
1036741617 8:11367386-11367408 AGTACATTAGTGGTTGCCGAGGG - Intergenic
1040578959 8:48679654-48679676 ATTTCATTGTTAGTTGCCAAGGG - Intergenic
1041068192 8:54102023-54102045 CGGACATTGTGAGGTGCCGAGGG - Intergenic
1043024294 8:75046833-75046855 TCTCCTTTGTTAATTGCCGAGGG - Intergenic
1044126790 8:88468892-88468914 TGTACATTTTTAGATGGTGAAGG - Intergenic
1044889243 8:96814970-96814992 AGTACATTGGTAGTTGCCAGGGG + Intronic
1046231484 8:111364300-111364322 TGCACAGTGTAAGTTGTCGATGG + Intergenic
1056405760 9:86273269-86273291 TGTACATTGTTAGTTGCCGATGG - Intronic
1059527328 9:115004716-115004738 TGCACATGGTAAGTTGCAGAAGG - Intergenic
1188020943 X:25157008-25157030 AATACATTGTTGGTTGCCTAGGG + Intergenic
1189387769 X:40551320-40551342 TGCACATTGTTAGGTGCTGCTGG - Intergenic
1197422458 X:126255507-126255529 TGTAGAATGGTAGTTGCCAAGGG - Intergenic
1198092647 X:133346850-133346872 TGTAGATTCTTGGTTGCCCAGGG + Intronic