ID: 1056406340

View in Genome Browser
Species Human (GRCh38)
Location 9:86279427-86279449
Sequence TTCTAGATATGTAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056406336_1056406340 4 Left 1056406336 9:86279400-86279422 CCTGCAAGTTCAATTCCACTTGT 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1056406340 9:86279427-86279449 TTCTAGATATGTAGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056406340 Original CRISPR TTCTAGATATGTAGGGAAAT AGG Intronic
No off target data available for this crispr