ID: 1056406838

View in Genome Browser
Species Human (GRCh38)
Location 9:86282775-86282797
Sequence GCGTGACGTCGGGGAGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056406827_1056406838 13 Left 1056406827 9:86282739-86282761 CCGGGAGGAATGTCTTCACCGCC No data
Right 1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG No data
1056406831_1056406838 -5 Left 1056406831 9:86282757-86282779 CCGCCGAGGACGGAGTCGGCGTG No data
Right 1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG No data
1056406826_1056406838 14 Left 1056406826 9:86282738-86282760 CCCGGGAGGAATGTCTTCACCGC No data
Right 1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG No data
1056406832_1056406838 -8 Left 1056406832 9:86282760-86282782 CCGAGGACGGAGTCGGCGTGACG No data
Right 1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056406838 Original CRISPR GCGTGACGTCGGGGAGCGGG CGG Intergenic
No off target data available for this crispr