ID: 1056408264

View in Genome Browser
Species Human (GRCh38)
Location 9:86297966-86297988
Sequence CAGTGTGGCAGGAGTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056408264_1056408268 -5 Left 1056408264 9:86297966-86297988 CCTGTTCCACTCCTGCCACACTG 0: 1
1: 0
2: 2
3: 45
4: 376
Right 1056408268 9:86297984-86298006 CACTGCCTCAGTGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056408264 Original CRISPR CAGTGTGGCAGGAGTGGAAC AGG (reversed) Intronic
900468468 1:2837744-2837766 AAGTGTGCCAGGAGTGGACATGG - Intergenic
900696878 1:4017716-4017738 CAGTGTGGGAGGTTTGGACCAGG + Intergenic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901202208 1:7473220-7473242 GCCTGGGGCAGGAGTGGAACCGG - Intronic
901926082 1:12567112-12567134 CAGGGTGGCAGGAGGGGAGCAGG - Intergenic
902654812 1:17859917-17859939 CTGTGTGGAAGGAGTGGCAGAGG + Intergenic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903357908 1:22759418-22759440 CAGGGTGGCAGGAATGGCCCGGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904829066 1:33295110-33295132 CAGGGGGTCAGGAGAGGAACAGG - Intronic
905868753 1:41391165-41391187 CAGGGTGGCAGGGATGGAGCAGG + Intergenic
907272399 1:53298677-53298699 CACTGGGGTAGGAGTGGAAGGGG - Intronic
907313599 1:53553837-53553859 CTGTGTGGCTGGAGCAGAACGGG + Intronic
907408203 1:54266954-54266976 CATTGTGGCAAGAATGAAACTGG - Intronic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
907869196 1:58427514-58427536 CAGGGTGGCAGCAGTGCAGCTGG + Intronic
908828003 1:68151994-68152016 TAGGGTGGCAGCAGTGGAATTGG + Intronic
910220172 1:84881726-84881748 CAGGGAGGCAGGATTGGAAAGGG + Intronic
912207342 1:107523218-107523240 CTGTGTGGCTGGAGCAGAACAGG - Intergenic
915605402 1:156947232-156947254 CAGTGGGGCCAAAGTGGAACAGG + Intronic
915635919 1:157186471-157186493 CATTGCAGCAGGAGAGGAACAGG - Intergenic
916074703 1:161193661-161193683 CAGTGTTGCAGGAGCGGAAGCGG + Exonic
916400719 1:164445647-164445669 CAGGGAGGCAGGAGTAGAACAGG + Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916613721 1:166418571-166418593 CAGTGTGGCACTAGAGGGACGGG + Intergenic
916618610 1:166471719-166471741 AAGGGTGGTGGGAGTGGAACTGG - Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
918042883 1:180923894-180923916 CAGTGGGGCAGGATGGGAGCTGG - Intronic
918306660 1:183252568-183252590 CAGAGAGGCAGGAGAGAAACAGG + Exonic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919359333 1:196570966-196570988 CAGTGTGGTAGGAGTAGGCCAGG - Intronic
920284570 1:204870465-204870487 CAGTGTGGCGGGGGTGGTCCTGG - Intronic
920613246 1:207463373-207463395 CAGTGTCTCTGGAGTGGATCAGG - Intronic
920693285 1:208163164-208163186 GAGTGTGGCAGAAGTGGCATGGG + Intronic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
921712525 1:218387226-218387248 CAGTATGGCAGGGGTGGGAGGGG + Intronic
922193396 1:223339448-223339470 CAGCGGGGCAGGGGTGGGACAGG + Intronic
922731906 1:227952876-227952898 CAGTGGGGCAGGAGTGGCCCTGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923229497 1:231971550-231971572 CAGGGTGGCTGGAGAGGAAGGGG - Intronic
924210689 1:241764098-241764120 CAGTGTGGCTGGAGTAATACTGG + Intronic
1063991489 10:11569577-11569599 CTTTTTGGCAGGAGTGGCACTGG + Intronic
1064034018 10:11900965-11900987 CACTGTGGCAGGCGTGGCGCTGG + Intergenic
1064218139 10:13417603-13417625 CACAGGGGCAGGAGTGAAACAGG + Intergenic
1064824624 10:19382837-19382859 CTGAGTAGCAGGAGTGGTACAGG - Intronic
1065145546 10:22764272-22764294 CAGTGGGGCAGGGGTGGTGCTGG + Intergenic
1065241569 10:23710135-23710157 TAGAGTGGCAGGTGTGGGACGGG + Intronic
1066632435 10:37470137-37470159 CAAAGTGGCAGCTGTGGAACTGG + Intergenic
1070280631 10:75045660-75045682 CAGTGTGGCTGAAGTGGCAAGGG + Intronic
1070383855 10:75906063-75906085 CTCTGTGGCAGGGGTGGAGCTGG - Intronic
1071474117 10:86010460-86010482 CATGTTGGCAGGAGTGGGACTGG + Intronic
1071741738 10:88366339-88366361 CAGGGGTGCAAGAGTGGAACTGG + Intronic
1073134408 10:101212192-101212214 CTGTGTGACAGGAGGGGTACTGG - Intergenic
1073272838 10:102280796-102280818 CCATGTGGCAGGAGTGCAGCTGG + Intronic
1073454294 10:103627243-103627265 CAGGGTGGCAGGGGTGGCTCGGG + Intronic
1075101033 10:119506403-119506425 CAGTGTGCCAGGGGTGGGATTGG + Intronic
1075713683 10:124544001-124544023 CACTGTCCCAGGAGAGGAACTGG - Intronic
1076027648 10:127129670-127129692 CACAGTCTCAGGAGTGGAACTGG + Intronic
1076653378 10:132005269-132005291 CAGTGTGCCAGGAGTGTGATTGG - Intergenic
1077178975 11:1203839-1203861 CAGTGTGCCCGGGGTGGATCAGG + Intergenic
1077324983 11:1959785-1959807 CAGCGTGGCAGGAGTGGGAGAGG + Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078789731 11:14530322-14530344 AAAGGTGGCAGGAGTGGAAAGGG - Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1080708134 11:34718780-34718802 CAATGTGGCTGGAGCAGAACAGG + Intergenic
1081759172 11:45565000-45565022 CAGGGTGGTAGCAGTGGAAGAGG + Intergenic
1081963715 11:47156908-47156930 CACTGAGGCTGGTGTGGAACTGG + Intronic
1081983477 11:47284857-47284879 CAGTTTGGCAGGGCTGGACCAGG - Intronic
1083478146 11:62926919-62926941 AAGTGTCTCAGGAGAGGAACCGG - Intergenic
1083549298 11:63574265-63574287 CAATGTGGGAGGAGAGGAGCAGG + Exonic
1083860534 11:65417839-65417861 CAGCGTGGCAGGGTGGGAACAGG + Intergenic
1083949441 11:65945940-65945962 CAGGGAGGCAGGAGTGGGACAGG + Intronic
1084190334 11:67495758-67495780 CATTCTGGCAGGAGTGCAGCTGG - Intronic
1084427594 11:69094136-69094158 CAGTGGGGCAGAAGTGGGGCGGG + Intergenic
1084493117 11:69488954-69488976 CAGTTTGGCAGGTGTGGCAGAGG - Intergenic
1084938289 11:72598959-72598981 TAGGGTGGCAGGAGGGCAACGGG + Intronic
1085597865 11:77826602-77826624 CAGTGTAGCAGGAGTGTACTTGG - Intronic
1085677496 11:78538148-78538170 CAGTGTGACATCAGTGGACCAGG - Intronic
1088250751 11:107858999-107859021 CAGGGTGGCAGGAGGAGAAAGGG + Exonic
1088357790 11:108961296-108961318 CAGAGTCGCAGCAGTGGAGCTGG + Intergenic
1088650500 11:111953739-111953761 CACAGTGGAAGGAGTGGAAAAGG + Intronic
1088783083 11:113155147-113155169 CAGTGAGGAAGGAGAGGAACTGG + Intronic
1090390847 11:126386322-126386344 CACTGTGGCAGGACAGAAACAGG - Intronic
1090469711 11:126969365-126969387 CAGTGTGGCAGGTGTGAAGGTGG + Intronic
1090877835 11:130806797-130806819 CAGGGTGGGAGGAGGGGAATGGG - Intergenic
1202807965 11_KI270721v1_random:14964-14986 CAGCGTGGCAGGAGTGGGAGAGG + Intergenic
1091403703 12:196262-196284 CTGTGGGCCAGGAGGGGAACTGG + Intronic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1095554503 12:43483955-43483977 CTGTGTGGCTGGAATGGAAGAGG - Intronic
1096085993 12:48865442-48865464 CGGGGCGGCAGAAGTGGAACAGG + Intronic
1097122963 12:56750098-56750120 CAGTGTGGCAGGAATGAATGAGG + Intronic
1097161350 12:57048574-57048596 GGGTGGGGCAGGGGTGGAACAGG + Intronic
1097573816 12:61365586-61365608 CAGTGGAGCAGGAGTGGAATGGG - Intergenic
1098461431 12:70736982-70737004 CAGTGGGGCAGGAGAGGATGGGG - Intronic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1101646881 12:106639365-106639387 CAGAGTAGCAGGAGTGGAGTGGG - Exonic
1102264428 12:111470866-111470888 CAGAGTGGCAGAAGTGGGAGTGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1103834408 12:123807621-123807643 GAGGGTGGCAGGGGTGGATCAGG + Intronic
1105533774 13:21244854-21244876 TATAATGGCAGGAGTGGAACGGG + Intergenic
1106100814 13:26694242-26694264 CAGTGTGGCAGGATCTGACCGGG - Intergenic
1106126434 13:26903530-26903552 AAGGGTGGTGGGAGTGGAACTGG + Intergenic
1106352654 13:28948742-28948764 GTGTGTGGCAGCAGGGGAACAGG + Intronic
1109446699 13:62448534-62448556 AATTGTGGCAGAAGGGGAACGGG - Intergenic
1113321399 13:109235801-109235823 CAGTTTGGCAGGGGAGGAGCTGG + Intergenic
1114318564 14:21527527-21527549 CAGTGAGGCAAGAATAGAACTGG - Intronic
1114503561 14:23190574-23190596 CAGGGTGGTAGCAGTGGAAATGG - Intronic
1115618319 14:35117546-35117568 CAGTGAGGCTGAAGTGGAAATGG - Intronic
1116743882 14:48792884-48792906 CAGTGTGGCTGCAGTGGCCCTGG - Intergenic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1118333746 14:64834347-64834369 CAGTCTAGCAGGAGAGGAAGAGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119317837 14:73710220-73710242 CAGTGTGTCAAGAGTGTAAGAGG + Intergenic
1120795865 14:88632252-88632274 CAGGGTGGCAGGAGTGAATGTGG - Intronic
1120972288 14:90217748-90217770 CTGTATGCCAGGAGTGGCACTGG + Intergenic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121498221 14:94412505-94412527 CAGTATAGCTGGAGTGGAATGGG - Intergenic
1121880941 14:97499849-97499871 CAGGGAGGCAGGAGTTGCACAGG - Intergenic
1122005156 14:98697392-98697414 CAGAGAGGCAGGAGTGGAGGTGG + Intergenic
1122150730 14:99724790-99724812 CAGAGAGCCAGGGGTGGAACAGG + Intronic
1122312931 14:100808627-100808649 CAATCTGGCAGCAGTGGAGCAGG - Intergenic
1122959144 14:105086736-105086758 GACTGTGGCAAGAGGGGAACAGG - Intergenic
1124060792 15:26292098-26292120 CAGTGTCGAAGGAGTGCAGCAGG - Intergenic
1124633371 15:31349822-31349844 CAAAGTGGCAGGAGGGGACCTGG - Intronic
1124648731 15:31459019-31459041 CAGTGTGGCGAGTGTGGAAGGGG - Intergenic
1125967198 15:43884042-43884064 TAGTGTGGCAGCAGTGCCACTGG + Intronic
1127836460 15:62794743-62794765 CAGTCTGGCAGGAGAGGCACAGG - Intronic
1128290931 15:66477776-66477798 CTGGGTGGGAGGAGTGGAAGAGG + Intronic
1128456602 15:67834894-67834916 CGGTGTGGCAGGCGTGGAAATGG - Intergenic
1130580841 15:85135537-85135559 CAGTGGGGCAGGATGAGAACAGG - Intronic
1130676702 15:85959166-85959188 CAATGTGCCAGGAGTGGTATTGG + Intergenic
1130948909 15:88570319-88570341 AAGTGTGGCAGGCAGGGAACAGG + Intergenic
1132219265 15:100093171-100093193 CAGTGTGGCACCAGGGGAAGTGG - Intronic
1132604447 16:787993-788015 CTGTGGGGCAGGTTTGGAACGGG - Intronic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1133026858 16:2992367-2992389 CAGTGTGTGAGGGGTGGATCTGG - Intergenic
1133058899 16:3161621-3161643 CATGGTGCCAGGAGGGGAACAGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133837130 16:9377343-9377365 CAGTGTGGCTGGTCTGGAAGGGG - Intergenic
1133944870 16:10339748-10339770 AAGGGTGGTGGGAGTGGAACTGG + Intronic
1137299480 16:47133994-47134016 CAGAGTGGTAGCAGTGGAAAGGG + Intronic
1137578562 16:49620283-49620305 CACTGTGGCAGGACTGGCCCTGG - Intronic
1138537671 16:57668420-57668442 CAGCGTGGCAGGAGGGGATGAGG - Intronic
1138608957 16:58107819-58107841 CAGTGTGCCAGGGGTGGATATGG - Intergenic
1139663129 16:68435686-68435708 CTGAGGGGCAGGAGTGGGACTGG + Intronic
1140420584 16:74815756-74815778 CAGGGTGGCCGCAGTGGAAGTGG + Intergenic
1140474873 16:75234845-75234867 CAGCGTGGCAGAAGAGGAGCCGG + Intronic
1140844222 16:78871319-78871341 CACAGTGGCAGGAGAGGGACTGG + Intronic
1141635069 16:85310206-85310228 CTGGGTGGCAGGAGAGGACCCGG + Intergenic
1141664527 16:85459007-85459029 CAGGGTGGCAGGAGCGAAAGCGG - Intergenic
1143218371 17:5241453-5241475 AAGGGTGGTGGGAGTGGAACTGG - Intergenic
1143598128 17:7927890-7927912 CAGTCTGGAAGGAGAGGAGCTGG - Intronic
1143651638 17:8267138-8267160 CTGTGTGGCAGAGGAGGAACGGG + Exonic
1144465827 17:15496442-15496464 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1146031354 17:29368830-29368852 CATAGTGGCATTAGTGGAACTGG + Intergenic
1146572891 17:33968228-33968250 CAGTGTAGCAGGAAGGGCACTGG - Intronic
1147002924 17:37377845-37377867 CAGAGGGGGAGGAGGGGAACCGG - Intronic
1147018790 17:37514023-37514045 GAGTGTCCCAGGAGTGGGACAGG - Intergenic
1147037179 17:37690465-37690487 CAGTGGGGCAAGGGTGGAAGTGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147855400 17:43475906-43475928 CAGTGTGGGAGGGGAGAAACAGG + Intergenic
1148019899 17:44546847-44546869 CATTATGGCAGGAGGGGAAATGG - Intergenic
1148139965 17:45321327-45321349 CAGGGAGGCAGGAGGGGAAATGG + Intergenic
1150250390 17:63701224-63701246 CACTGTGGCAGGAATAGCACTGG + Intergenic
1150256695 17:63751753-63751775 CAGTGTGGCACGGCTTGAACAGG + Intronic
1150758435 17:67937620-67937642 CCCTGAGGCAGGAGTGGACCTGG + Intronic
1150977792 17:70108586-70108608 TAGTGATGAAGGAGTGGAACAGG - Intronic
1151185266 17:72359533-72359555 AAGTGAGGCAGGAGAGGAGCTGG + Intergenic
1151480953 17:74369813-74369835 CAGTGTGGCTTCAGGGGAACAGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152488927 17:80615680-80615702 AGGTGTGGCAAGAGTGGAATGGG - Intronic
1153235145 18:2979045-2979067 AAGTGAGGCAGGAAAGGAACAGG - Intronic
1153481708 18:5553941-5553963 CAGAGTGCCTGGAGTGGGACGGG - Intronic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155267037 18:24104325-24104347 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1157081980 18:44535255-44535277 CAGTGTGGCAGCAATGTAAAGGG + Intergenic
1157557345 18:48621545-48621567 CAGTGAGGCAGGAGGGAACCAGG + Intronic
1157911138 18:51618238-51618260 TAGTGCGCCAGGAGTGGCACTGG + Intergenic
1158423978 18:57322590-57322612 CAGTTTGGCAGGGAAGGAACAGG + Intergenic
1160579472 18:79875400-79875422 CAGTGAAGCTGGAGTGGAAATGG - Intronic
1161354488 19:3811247-3811269 CAGGGGGGCAGGGGTGGAGCAGG - Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1162330881 19:10028756-10028778 AAGGGTGGTTGGAGTGGAACTGG + Intergenic
1162467102 19:10848876-10848898 CAGTGTGGCAGGGGTGGGTGGGG + Intronic
1162994266 19:14323954-14323976 CAGTGGGGCAGGAGCTGATCGGG - Intergenic
1163370764 19:16900031-16900053 CAGTGTGGGGAGGGTGGAACAGG - Intronic
1163571544 19:18085088-18085110 CAGTCTGCTAGGTGTGGAACTGG + Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165072689 19:33264685-33264707 CAGTCTGGCAGGAGGTGAGCAGG - Intergenic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1166206764 19:41275146-41275168 CTGGGTGGCAGGTGTGGATCAGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166280359 19:41788480-41788502 CAAAGTGGCAGGAGTGGAGGGGG - Intergenic
1167496666 19:49823255-49823277 CAGTATGGCAGAAGTGGACTTGG - Intronic
925851875 2:8089683-8089705 CAGTGTGGAAGTAGACGAACAGG - Intergenic
926163961 2:10506612-10506634 GAGTGTGGCAGGAGGGGTGCAGG - Intergenic
926246812 2:11127854-11127876 CAATGTGGTAGAAGTGGCACAGG + Intergenic
926420895 2:12697594-12697616 CAGTGTGACAGAATTTGAACAGG - Intergenic
926799012 2:16642506-16642528 CAGGGTGTCAGGGGTGGAACTGG - Intronic
927378624 2:22450767-22450789 CAGTGATACAGGAGGGGAACTGG - Intergenic
927982352 2:27381894-27381916 CAGGGTGGTAGGAGAGGAATGGG + Intronic
928140465 2:28724124-28724146 CTGTGTGGCGGGAGTAGATCAGG - Intergenic
929768251 2:44868895-44868917 CAGTGTGTCAGGAGAGGACTGGG + Intergenic
929773281 2:44911109-44911131 CATGGTGGCAGGAGGGGAAGGGG + Intergenic
929979672 2:46666583-46666605 CACTGTGGCAGGCTTGGAATTGG + Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931110122 2:59101269-59101291 CAGTGTGGCTAGAGTAAAACAGG - Intergenic
931621204 2:64211477-64211499 CAGTGTGGCAAGGGTAGAAGTGG - Intergenic
933690846 2:85178492-85178514 CAGGGTGGCAGGGGTGGGAAGGG + Intronic
933945317 2:87281183-87281205 CAGTGTGTCCTGAGTGGCACAGG + Intergenic
935793454 2:106615522-106615544 CAGAGTGGCAGGAGTGGATTTGG + Intergenic
936334892 2:111580408-111580430 CAGTGTGTCCTGAGTGGCACAGG - Intergenic
937206207 2:120238696-120238718 CAGTGGGGCAGGAGGAGGACAGG + Intergenic
937214361 2:120301981-120302003 CAGCCTGGCAGAAGTGGAAGCGG - Intergenic
940649629 2:156428600-156428622 CAGTTAGGCAGGAAGGGAACAGG + Intergenic
940807916 2:158208542-158208564 CAGGGTGGCACGACAGGAACAGG + Intronic
940994081 2:160128379-160128401 GAGTGTGGCAGGTGGGGAAATGG + Intronic
941045806 2:160674477-160674499 GAATGTGGCAGCAGTGGCACTGG - Intergenic
941790003 2:169541860-169541882 CAGTGTGGCAGGAGTAGATGAGG - Intronic
942692375 2:178599622-178599644 CAGTCTCGCAGGAGTGACACTGG - Exonic
946007733 2:216540034-216540056 CACTGTGGCAGGAGAGGCCCTGG + Intronic
946183865 2:217965801-217965823 CAGGGTGGCTGGTGTGGACCAGG + Intronic
946236484 2:218327425-218327447 CAGCCTGGCAGGAGGGGAGCAGG + Intronic
947035623 2:225851120-225851142 CAGTGTGGCAGAGGTGGAGGAGG + Intergenic
947446951 2:230171563-230171585 CAGCGTGGCAGCAGTGGAGCGGG - Intronic
947712146 2:232322374-232322396 CAGTGTGGCAGGGCTGGATGTGG - Intronic
948230606 2:236346455-236346477 CAGTGTGGCAGAAGCAGGACTGG + Intronic
948297121 2:236869081-236869103 CAGTTTGGAAGGAGGGGAAAGGG - Intergenic
948660500 2:239503586-239503608 CGGGATGGCAGGAGTGGAGCTGG + Intergenic
1168891516 20:1297903-1297925 GAGAGTGGCAGAGGTGGAACTGG + Intronic
1169975141 20:11316801-11316823 CAGTGTGACAGGAATAGAAAGGG + Intergenic
1172885106 20:38225685-38225707 CGGTGTGGCAGTAGGGGAAGGGG + Exonic
1173008094 20:39156597-39156619 CAGAGTGGCTGGAGTTGAACAGG + Intergenic
1173403834 20:42747932-42747954 CAATGGGGCAAGAGTGGAGCAGG + Intronic
1174081843 20:47975522-47975544 CAGCGTGGCAGGAAGGGAGCTGG - Intergenic
1175579029 20:60084843-60084865 AAGTGTGGCATTAGAGGAACTGG - Intergenic
1176036018 20:63036987-63037009 CAGTGTGGGAGGAGCGGGAGGGG + Intergenic
1177955583 21:27594494-27594516 CAGTCTGGGAGGAGGAGAACTGG - Intergenic
1178043817 21:28671593-28671615 CAGTGTGGTAGGAGTGGGGTGGG + Intergenic
1178492906 21:33064754-33064776 CAATGGGGAAGGAGTGAAACCGG + Intergenic
1178623636 21:34197942-34197964 CAGTGTTGGAGGGGTGGAAGTGG + Intergenic
1178902608 21:36609367-36609389 CAGTGTGGGAGGAGTGAACTGGG - Intergenic
1179039385 21:37788612-37788634 GAGTGTGGCAGAAGTGAAAAAGG + Intronic
1179882955 21:44300922-44300944 CAGTGTGGCACCTGTGGCACAGG + Intronic
1179979150 21:44887514-44887536 CAGGATGGCAGGAGGGGTACAGG - Intronic
1180131672 21:45830661-45830683 CAGTGGGGAAGGGGTGGAAAGGG - Intronic
1180987770 22:19915447-19915469 CAGCCTGGCAGGAGGGGGACAGG + Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1181861421 22:25822135-25822157 CAGTGTGGCTGGAATGTAACGGG - Intronic
1181947782 22:26531740-26531762 AAGTGGGGCAGTCGTGGAACTGG - Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182009983 22:26992555-26992577 CAGTGAGGCAGTAGTAGACCTGG - Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1183292736 22:37012628-37012650 CAGGGTGGCAGGAGTGGGAGGGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953518045 3:43616289-43616311 CGGTGTGGCAGAAGCAGAACTGG + Intronic
954317687 3:49810196-49810218 CAGTGGGTCAGAAGTGGGACTGG + Intronic
954570639 3:51638049-51638071 AGGTGTGGCAGGAGTGCAAAAGG + Intronic
955398099 3:58571790-58571812 AAGTGTGGCATGAGCTGAACAGG - Intronic
955408675 3:58642111-58642133 CATTGAGGCTGGAGTGGAACAGG + Intronic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
956852857 3:73246821-73246843 GAGAGGGGCAGGAGTGGTACTGG - Intergenic
958103776 3:89047715-89047737 CAGTGTGTCAGTTGTGGAACTGG - Intergenic
959146915 3:102557714-102557736 CAGGGTGGCAGAAATGGAAGAGG - Intergenic
960143347 3:114172537-114172559 AAGTGAGGCAGGAGTAGAATAGG + Intronic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960945542 3:122963981-122964003 TAGTGGGGCAGGGGTGGAAGTGG - Intronic
962356696 3:134700245-134700267 CAGCGCGGCAGGAATGGAAGTGG - Intronic
962486182 3:135844866-135844888 CAGGGTGGCAGCAGTGGAAGTGG + Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
964221535 3:154352391-154352413 CAGTGTGGCACGATTCCAACTGG - Intronic
964985412 3:162732325-162732347 AAGGGTGGTGGGAGTGGAACTGG - Intergenic
966869898 3:184283637-184283659 CAGTGTGTCAGAAATGAAACAGG + Intronic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
969338027 4:6522979-6523001 CAGCCTGGCAGGGGTGGACCGGG + Intronic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969423706 4:7111726-7111748 CAGTGTGGCAGCAGTGGTGAAGG + Intergenic
969628815 4:8323327-8323349 CAGTGGGGCAGGCCTGGAAGTGG + Intergenic
970301539 4:14686227-14686249 CAGTATGGCAGGAGTAGAGCAGG + Intergenic
971241542 4:24893655-24893677 CAATCAGGCTGGAGTGGAACGGG + Intronic
971268831 4:25118282-25118304 CAGTTTGGCTGGAATGGAGCAGG + Intergenic
973846008 4:54914025-54914047 CAGTGTGTGAGTTGTGGAACCGG - Intergenic
974413227 4:61569065-61569087 TAGTGTGGCAGGGGTGGGAGTGG + Intronic
974893418 4:67908382-67908404 CATTTGGGGAGGAGTGGAACAGG - Intergenic
975547137 4:75571347-75571369 CAGTGTGTCTGGAGTGGGAAAGG - Intergenic
976075340 4:81291918-81291940 CAGTAGGCCAGGAGTGGCACAGG + Intergenic
976154303 4:82126053-82126075 GAGGGGGGCAGGAGTGGAAGGGG - Intergenic
977393023 4:96437425-96437447 CAAGGTGGCAGGAGAGAAACAGG + Intergenic
979268506 4:118731986-118732008 CAGTGTGGCTGAAGTGGGATGGG + Intronic
979581982 4:122371495-122371517 TAGGGTGGCAGCAGTGGAAGTGG + Intergenic
980981603 4:139658911-139658933 CAGTGTGGTAGCAGTGGTATGGG + Intergenic
981701445 4:147611254-147611276 CAGTGTGGGAGGAGTTACACAGG + Intergenic
981771213 4:148310871-148310893 GAGTGTGGGAGGAGAGAAACTGG - Intronic
983695014 4:170517713-170517735 CATTGTGCCAGGAGGGGAAAAGG + Intergenic
985710373 5:1424446-1424468 CAGTGAGGGAGGAGTGGTCCGGG - Intronic
986032334 5:3905927-3905949 CAGCTTGGTAGGAGTGGAAGTGG - Intergenic
987036670 5:14026012-14026034 CAGTTTGACAGGAGTGAAAGTGG + Intergenic
988208866 5:28176429-28176451 CAGGGTGGCAGAAATGGAACAGG + Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
991390673 5:66140365-66140387 CAGAGTGGCAGGGCTGGAACAGG + Intronic
991446198 5:66702677-66702699 GAGTGTGGCTGGAGCAGAACAGG + Intronic
992879969 5:81098055-81098077 CAGCATGGCAGGAGTGGAGTTGG + Intronic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
995861968 5:116650661-116650683 CTGTCTGGCAGGAGTGGCATGGG - Intergenic
996526073 5:124481145-124481167 AAGAGTGGCATGAGTGGAAGAGG + Intergenic
996549241 5:124712532-124712554 CAGAGTGGCTGGAGAGGGACTGG + Intronic
996729410 5:126703004-126703026 AAGGGTGGTGGGAGTGGAACTGG + Intergenic
997197711 5:131990797-131990819 CTGTGTGGCAGGGGTGGAGTGGG - Intronic
997453396 5:134001222-134001244 CAGCCTGGCAGGAGTGGAGTTGG - Intronic
997734020 5:136200339-136200361 CAGTGTGGCAGAAGTGTCACTGG + Intergenic
997865576 5:137459859-137459881 CAGAGGGGCAGGTTTGGAACTGG + Intronic
998253926 5:140570738-140570760 CAGTCTGGCTGGAGCTGAACAGG - Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999238067 5:150111693-150111715 CAGTGTGGCAGGGATGGGAGAGG - Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1000448329 5:161352543-161352565 CAGGCTGGCAGGAGTGGGACTGG + Intronic
1000672404 5:164078742-164078764 CACTGTGGCAGGAGAGAAGCAGG - Intergenic
1000868033 5:166538898-166538920 CCATGTGGCAGGGGTGGAAGAGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002855655 6:1035750-1035772 GTGTGTGCCAGGAGTGGAAGAGG + Intergenic
1003688022 6:8323712-8323734 CAGTGTGGCAGGAGAAGGGCAGG - Intergenic
1003989975 6:11476597-11476619 CAGTGTGACAGCAGTGGAGATGG + Intergenic
1005805164 6:29467984-29468006 CTGGGTGGGAAGAGTGGAACTGG - Intergenic
1006427774 6:33976865-33976887 CAGTGACGCAGGAGGGGCACAGG - Intergenic
1007060295 6:38933696-38933718 CAGGGTGGCAGGAGTTGATGGGG - Intronic
1007240219 6:40419507-40419529 CAGGTTGGCTGGAGTTGAACTGG - Intronic
1007259897 6:40556129-40556151 CAGTCTGGCAGGTGTAGAATTGG + Intronic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008878306 6:56353323-56353345 CAGTCTGGCAGCTGTGGAATAGG - Intronic
1010474035 6:76263973-76263995 GGGTGTGGCAAGAGTGGAGCTGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013752720 6:113425694-113425716 CAGTGTGGTAGAAGGGGAATTGG + Intergenic
1013938417 6:115629197-115629219 TAGTGTGGCAGGAGTCTAACTGG - Intergenic
1014004016 6:116396717-116396739 CAATGTGGCAGAAGTGGCAGGGG + Intronic
1015816898 6:137220005-137220027 CAATGTGGCTGCAGTGGAATAGG - Intergenic
1016562635 6:145414131-145414153 GAGTGTGGAAGGAGTTGATCTGG - Intergenic
1017602562 6:156099756-156099778 CAGGGTGGCAGGAGAGAAAAGGG - Intergenic
1017878029 6:158539812-158539834 CAGTTAGCAAGGAGTGGAACTGG - Intronic
1018987758 6:168650367-168650389 GAGTGTGGCAGCAGAGGCACCGG - Intronic
1019176604 6:170162418-170162440 CAGTGAGGCAGGAGAGCACCTGG + Intergenic
1019684450 7:2373211-2373233 CAGTGTGGCACCCCTGGAACCGG - Intronic
1019729778 7:2623504-2623526 GAGACTGGCAGGAGTGGAGCTGG + Intergenic
1019878773 7:3840245-3840267 CAGAGTGGGAGGAGCGGAAGAGG + Intronic
1022962065 7:35436902-35436924 CAGTGTTGCAAGGCTGGAACTGG + Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023277712 7:38538420-38538442 CAGGGTGGGAGGTGTGGAACTGG + Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023312492 7:38902340-38902362 CAGTGTGGCTGGAGGGTCACAGG - Intronic
1024212605 7:47218627-47218649 CAAGGAGGAAGGAGTGGAACTGG - Intergenic
1026530363 7:71192190-71192212 CAGTGTGGCTAGAATGAAACAGG - Intronic
1026794049 7:73354452-73354474 CCGCCTGGCAGGAGTGGAAGGGG + Intronic
1027046751 7:74996084-74996106 CAGAGGGGCAGGGGTGGAAGAGG + Intronic
1029386247 7:100245520-100245542 CAGAGGGGCAGGGGTGGAAGAGG - Intronic
1029705745 7:102274866-102274888 CAAAGGGGCAGGAGGGGAACTGG - Intronic
1030081765 7:105784548-105784570 CAGCATGGCAGGAGGGGAAGTGG + Intronic
1030359100 7:108576635-108576657 GAGGGTGGCAGCAGTGGAAGTGG + Intergenic
1030625943 7:111846301-111846323 CATATTGGCAGAAGTGGAACAGG + Intronic
1030887295 7:114954116-114954138 CAGGGTGGAATGAGTGAAACAGG - Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1033281524 7:140009704-140009726 GAGTGGGGCAGGTGTGGAGCGGG - Intronic
1034732542 7:153400519-153400541 GAGTGTGGAAGGAGGTGAACAGG - Intergenic
1034889289 7:154825683-154825705 CAGTGTGGCAGTTGGGGCACGGG - Intronic
1036656430 8:10680153-10680175 CAGTGTGGAAGGAGCGTCACTGG - Intronic
1037005291 8:13771055-13771077 CATAGTGGCAAGAGTGGAAGAGG + Intergenic
1038425905 8:27463593-27463615 CAGTGAGGCAGGAGATGAGCAGG + Exonic
1038583178 8:28767879-28767901 GAGGGTGGCAGAAGTGGGACAGG - Exonic
1038772197 8:30493380-30493402 CAGTGAGACAGGAGAGGAAAAGG + Intronic
1039119866 8:34133633-34133655 CAGGGTGGCAGAGGTGGAAGAGG - Intergenic
1040432967 8:47362073-47362095 AAGCTTGGCAGGTGTGGAACTGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043912296 8:85877033-85877055 CAGTGTAGCAGGAATAGCACAGG + Intergenic
1044804105 8:95987360-95987382 CAAGGTGGCTGGAGTGGAATGGG + Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045695325 8:104802504-104802526 AAGGGTGGCAGTAGTGGAAATGG + Intronic
1046276742 8:111971348-111971370 CAGTGTTGGAGGAGGGGACCTGG - Intergenic
1046294701 8:112202163-112202185 AAGGGTGGTGGGAGTGGAACTGG - Intergenic
1046761408 8:118025245-118025267 CGGTGAGCCAGGAGTGGATCTGG - Intronic
1046887837 8:119387611-119387633 CATGGTGGCAGGAGTGGGGCAGG - Intergenic
1048327527 8:133450847-133450869 CAGTGTACCAGGAGAGAAACAGG - Intergenic
1048504568 8:135009224-135009246 AAATGTGGCAGGAGTGACACTGG + Intergenic
1048896143 8:138994028-138994050 CAATGTGGCAGGAGGGGGAGAGG - Intergenic
1048977744 8:139682410-139682432 CAGGGTGGCAGGTGCTGAACTGG + Intronic
1049673454 8:143879591-143879613 CAGTGTGGCAGGTGTGGACAGGG - Intergenic
1049768429 8:144366883-144366905 CAGTGTGGCAGTATTGGAGGTGG - Intergenic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1051145479 9:14022938-14022960 AAGTGAGGCAAGAGTGGAAGAGG - Intergenic
1051773677 9:20610135-20610157 CAGTGTGGCAGGAAAGGCCCTGG - Intronic
1052534121 9:29726377-29726399 CAGTGTGGAAGCACTGGTACTGG + Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1057744461 9:97740243-97740265 CAGTGCAACAGGAGTGGAATGGG + Intergenic
1058906496 9:109486431-109486453 CAGTTTGGGTGGAGTGGAAAAGG + Intronic
1059859464 9:118442630-118442652 GAGTGTGGTAGCAGTGGAAGTGG - Intergenic
1060043641 9:120323296-120323318 CAGTGAGTAAGCAGTGGAACTGG - Intergenic
1060641460 9:125242138-125242160 CAGTGTGGGAGGGCTGGCACTGG - Intergenic
1060826719 9:126692007-126692029 CAGTGGGGAAGGACTGGAGCAGG + Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061070128 9:128304534-128304556 CAGTGTGGGAAGAGAGGAACTGG + Intergenic
1061676076 9:132216521-132216543 CAGTGGGGCAGGGGTGGAGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061854141 9:133432596-133432618 CTGTGTGGCAGGAGAGGGCCTGG - Exonic
1061870532 9:133517931-133517953 CAGTGTGGCTGGGCTGGACCAGG + Intronic
1062209629 9:135356658-135356680 CTGTGTGGCAGGTGGGGACCTGG + Intergenic
1062519117 9:136950323-136950345 CAGGGCGGCAGGAGTGGGTCTGG + Intronic
1203785640 EBV:126073-126095 CAGTTGGGGAGGAGGGGAACTGG - Intergenic
1188881462 X:35497034-35497056 GAGTGTGGTGGGAGTGGAACTGG - Intergenic
1192215750 X:69156961-69156983 GAGGGTGGCAGGAGGGGAAGGGG + Intergenic
1192682772 X:73268774-73268796 TACTGTGACAGGAGTGTAACTGG + Intergenic
1192727132 X:73765341-73765363 CACTGTGTCAGGAGTGTGACTGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1199970102 X:152853459-152853481 CAGGGTGGCAGCAATGGAAGGGG - Intronic
1201385176 Y:13432608-13432630 CAGTGTGGTAGCAGTGGATTGGG - Intronic