ID: 1056417386

View in Genome Browser
Species Human (GRCh38)
Location 9:86390112-86390134
Sequence GAGGATTAGCTGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056417375_1056417386 24 Left 1056417375 9:86390065-86390087 CCTGGTTCATTTCACTGGGACTG 0: 11
1: 345
2: 850
3: 1283
4: 1019
Right 1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056417386 Original CRISPR GAGGATTAGCTGAAGCAGGG TGG Intergenic
No off target data available for this crispr