ID: 1056426647

View in Genome Browser
Species Human (GRCh38)
Location 9:86484160-86484182
Sequence CACTTTTGCTAATGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056426641_1056426647 -6 Left 1056426641 9:86484143-86484165 CCATGTCTCTCCCATGGCACTTT No data
Right 1056426647 9:86484160-86484182 CACTTTTGCTAATGGGCAGTGGG No data
1056426638_1056426647 11 Left 1056426638 9:86484126-86484148 CCTCCTTGGCATGTGCTCCATGT No data
Right 1056426647 9:86484160-86484182 CACTTTTGCTAATGGGCAGTGGG No data
1056426637_1056426647 22 Left 1056426637 9:86484115-86484137 CCTTGTTACAGCCTCCTTGGCAT No data
Right 1056426647 9:86484160-86484182 CACTTTTGCTAATGGGCAGTGGG No data
1056426639_1056426647 8 Left 1056426639 9:86484129-86484151 CCTTGGCATGTGCTCCATGTCTC No data
Right 1056426647 9:86484160-86484182 CACTTTTGCTAATGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056426647 Original CRISPR CACTTTTGCTAATGGGCAGT GGG Intergenic
No off target data available for this crispr