ID: 1056429854

View in Genome Browser
Species Human (GRCh38)
Location 9:86516526-86516548
Sequence ACACTACTGTTCATGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056429851_1056429854 14 Left 1056429851 9:86516489-86516511 CCAGGCGACGAGGCAAGGGGCCA No data
Right 1056429854 9:86516526-86516548 ACACTACTGTTCATGGACAGTGG No data
1056429852_1056429854 -6 Left 1056429852 9:86516509-86516531 CCAATTGAGCTGATAACACACTA No data
Right 1056429854 9:86516526-86516548 ACACTACTGTTCATGGACAGTGG No data
1056429850_1056429854 15 Left 1056429850 9:86516488-86516510 CCCAGGCGACGAGGCAAGGGGCC No data
Right 1056429854 9:86516526-86516548 ACACTACTGTTCATGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056429854 Original CRISPR ACACTACTGTTCATGGACAG TGG Intergenic
No off target data available for this crispr