ID: 1056430878

View in Genome Browser
Species Human (GRCh38)
Location 9:86526705-86526727
Sequence TTGGACAGTGACTTGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056430873_1056430878 0 Left 1056430873 9:86526682-86526704 CCTGTGATTTCTGTACCTCTGCA No data
Right 1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG No data
1056430870_1056430878 12 Left 1056430870 9:86526670-86526692 CCCCTTGGTGTTCCTGTGATTTC No data
Right 1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG No data
1056430868_1056430878 25 Left 1056430868 9:86526657-86526679 CCTTGAGTCACTCCCCCTTGGTG No data
Right 1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG No data
1056430871_1056430878 11 Left 1056430871 9:86526671-86526693 CCCTTGGTGTTCCTGTGATTTCT No data
Right 1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG No data
1056430872_1056430878 10 Left 1056430872 9:86526672-86526694 CCTTGGTGTTCCTGTGATTTCTG No data
Right 1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG No data
1056430869_1056430878 13 Left 1056430869 9:86526669-86526691 CCCCCTTGGTGTTCCTGTGATTT No data
Right 1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056430878 Original CRISPR TTGGACAGTGACTTGAGGGC TGG Intergenic
No off target data available for this crispr