ID: 1056430891

View in Genome Browser
Species Human (GRCh38)
Location 9:86526791-86526813
Sequence CACATGCCCAGTGTTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056430891_1056430893 3 Left 1056430891 9:86526791-86526813 CCTTGAAGAACACTGGGCATGTG No data
Right 1056430893 9:86526817-86526839 AGGAGCGTCCCTGAAGTACACGG No data
1056430891_1056430898 19 Left 1056430891 9:86526791-86526813 CCTTGAAGAACACTGGGCATGTG No data
Right 1056430898 9:86526833-86526855 TACACGGGGCTTCCCATCCCTGG No data
1056430891_1056430899 22 Left 1056430891 9:86526791-86526813 CCTTGAAGAACACTGGGCATGTG No data
Right 1056430899 9:86526836-86526858 ACGGGGCTTCCCATCCCTGGAGG No data
1056430891_1056430895 5 Left 1056430891 9:86526791-86526813 CCTTGAAGAACACTGGGCATGTG No data
Right 1056430895 9:86526819-86526841 GAGCGTCCCTGAAGTACACGGGG No data
1056430891_1056430894 4 Left 1056430891 9:86526791-86526813 CCTTGAAGAACACTGGGCATGTG No data
Right 1056430894 9:86526818-86526840 GGAGCGTCCCTGAAGTACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056430891 Original CRISPR CACATGCCCAGTGTTCTTCA AGG (reversed) Intergenic
No off target data available for this crispr