ID: 1056431908

View in Genome Browser
Species Human (GRCh38)
Location 9:86536062-86536084
Sequence CCAACAACGCAGCTCTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056431908_1056431912 -1 Left 1056431908 9:86536062-86536084 CCATGCAAGAGCTGCGTTGTTGG No data
Right 1056431912 9:86536084-86536106 GCACGTGGGAATGAGACGTGAGG No data
1056431908_1056431914 24 Left 1056431908 9:86536062-86536084 CCATGCAAGAGCTGCGTTGTTGG No data
Right 1056431914 9:86536109-86536131 CTCTTTACATTTTGATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056431908 Original CRISPR CCAACAACGCAGCTCTTGCA TGG (reversed) Intergenic
No off target data available for this crispr