ID: 1056436239

View in Genome Browser
Species Human (GRCh38)
Location 9:86578152-86578174
Sequence CTCAGGCAGCAACCTATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056436239_1056436245 10 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436245 9:86578185-86578207 ACCACCCAAGAGCGGCTCCGGGG No data
1056436239_1056436242 2 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436242 9:86578177-86578199 TGTACTGGACCACCCAAGAGCGG No data
1056436239_1056436247 11 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436247 9:86578186-86578208 CCACCCAAGAGCGGCTCCGGGGG No data
1056436239_1056436243 8 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436243 9:86578183-86578205 GGACCACCCAAGAGCGGCTCCGG No data
1056436239_1056436250 21 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436250 9:86578196-86578218 GCGGCTCCGGGGGCCCTCTGAGG No data
1056436239_1056436251 22 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436251 9:86578197-86578219 CGGCTCCGGGGGCCCTCTGAGGG No data
1056436239_1056436244 9 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436244 9:86578184-86578206 GACCACCCAAGAGCGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056436239 Original CRISPR CTCAGGCAGCAACCTATTAG TGG (reversed) Intergenic
No off target data available for this crispr