ID: 1056436240

View in Genome Browser
Species Human (GRCh38)
Location 9:86578162-86578184
Sequence GTTGCTGCCTGAGACTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056436238_1056436240 -5 Left 1056436238 9:86578144-86578166 CCGAGATACCACTAATAGGTTGC No data
Right 1056436240 9:86578162-86578184 GTTGCTGCCTGAGACTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056436240 Original CRISPR GTTGCTGCCTGAGACTGTAC TGG Intergenic
No off target data available for this crispr