ID: 1056436242

View in Genome Browser
Species Human (GRCh38)
Location 9:86578177-86578199
Sequence TGTACTGGACCACCCAAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056436239_1056436242 2 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436242 9:86578177-86578199 TGTACTGGACCACCCAAGAGCGG No data
1056436238_1056436242 10 Left 1056436238 9:86578144-86578166 CCGAGATACCACTAATAGGTTGC No data
Right 1056436242 9:86578177-86578199 TGTACTGGACCACCCAAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056436242 Original CRISPR TGTACTGGACCACCCAAGAG CGG Intergenic
No off target data available for this crispr