ID: 1056436245

View in Genome Browser
Species Human (GRCh38)
Location 9:86578185-86578207
Sequence ACCACCCAAGAGCGGCTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056436239_1056436245 10 Left 1056436239 9:86578152-86578174 CCACTAATAGGTTGCTGCCTGAG No data
Right 1056436245 9:86578185-86578207 ACCACCCAAGAGCGGCTCCGGGG No data
1056436241_1056436245 -7 Left 1056436241 9:86578169-86578191 CCTGAGACTGTACTGGACCACCC No data
Right 1056436245 9:86578185-86578207 ACCACCCAAGAGCGGCTCCGGGG No data
1056436238_1056436245 18 Left 1056436238 9:86578144-86578166 CCGAGATACCACTAATAGGTTGC No data
Right 1056436245 9:86578185-86578207 ACCACCCAAGAGCGGCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056436245 Original CRISPR ACCACCCAAGAGCGGCTCCG GGG Intergenic
No off target data available for this crispr