ID: 1056438110

View in Genome Browser
Species Human (GRCh38)
Location 9:86592813-86592835
Sequence ACTTCCAAGCTCACTCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056438108_1056438110 -1 Left 1056438108 9:86592791-86592813 CCAAGCTGGAACTAGAGGATCAA No data
Right 1056438110 9:86592813-86592835 ACTTCCAAGCTCACTCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056438110 Original CRISPR ACTTCCAAGCTCACTCCTAT GGG Intergenic
No off target data available for this crispr