ID: 1056444440

View in Genome Browser
Species Human (GRCh38)
Location 9:86652215-86652237
Sequence GGTTTTAATGCAGGACAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056444436_1056444440 -9 Left 1056444436 9:86652201-86652223 CCCTGACTTATGATGGTTTTAAT No data
Right 1056444440 9:86652215-86652237 GGTTTTAATGCAGGACAAGTGGG No data
1056444437_1056444440 -10 Left 1056444437 9:86652202-86652224 CCTGACTTATGATGGTTTTAATG No data
Right 1056444440 9:86652215-86652237 GGTTTTAATGCAGGACAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056444440 Original CRISPR GGTTTTAATGCAGGACAAGT GGG Intergenic
No off target data available for this crispr