ID: 1056444965 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:86656679-86656701 |
| Sequence | CTCCATACAAAAGTGGAGTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056444965_1056444972 | 26 | Left | 1056444965 | 9:86656679-86656701 | CCAAACTCCACTTTTGTATGGAG | No data | ||
| Right | 1056444972 | 9:86656728-86656750 | CTTCCCAGAATGGTGCTATTGGG | No data | ||||
| 1056444965_1056444970 | 16 | Left | 1056444965 | 9:86656679-86656701 | CCAAACTCCACTTTTGTATGGAG | No data | ||
| Right | 1056444970 | 9:86656718-86656740 | TTTTTCTCTGCTTCCCAGAATGG | No data | ||||
| 1056444965_1056444971 | 25 | Left | 1056444965 | 9:86656679-86656701 | CCAAACTCCACTTTTGTATGGAG | No data | ||
| Right | 1056444971 | 9:86656727-86656749 | GCTTCCCAGAATGGTGCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056444965 | Original CRISPR | CTCCATACAAAAGTGGAGTT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||