ID: 1056444965

View in Genome Browser
Species Human (GRCh38)
Location 9:86656679-86656701
Sequence CTCCATACAAAAGTGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056444965_1056444972 26 Left 1056444965 9:86656679-86656701 CCAAACTCCACTTTTGTATGGAG No data
Right 1056444972 9:86656728-86656750 CTTCCCAGAATGGTGCTATTGGG No data
1056444965_1056444970 16 Left 1056444965 9:86656679-86656701 CCAAACTCCACTTTTGTATGGAG No data
Right 1056444970 9:86656718-86656740 TTTTTCTCTGCTTCCCAGAATGG No data
1056444965_1056444971 25 Left 1056444965 9:86656679-86656701 CCAAACTCCACTTTTGTATGGAG No data
Right 1056444971 9:86656727-86656749 GCTTCCCAGAATGGTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056444965 Original CRISPR CTCCATACAAAAGTGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr