ID: 1056449412

View in Genome Browser
Species Human (GRCh38)
Location 9:86701409-86701431
Sequence TCTTGTGGTGCAAGCCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056449412_1056449417 4 Left 1056449412 9:86701409-86701431 CCAGGTTGGCTTGCACCACAAGA No data
Right 1056449417 9:86701436-86701458 AGAGGTAGAAGTGACATTCGGGG No data
1056449412_1056449415 2 Left 1056449412 9:86701409-86701431 CCAGGTTGGCTTGCACCACAAGA No data
Right 1056449415 9:86701434-86701456 TGAGAGGTAGAAGTGACATTCGG No data
1056449412_1056449418 5 Left 1056449412 9:86701409-86701431 CCAGGTTGGCTTGCACCACAAGA No data
Right 1056449418 9:86701437-86701459 GAGGTAGAAGTGACATTCGGGGG No data
1056449412_1056449419 24 Left 1056449412 9:86701409-86701431 CCAGGTTGGCTTGCACCACAAGA No data
Right 1056449419 9:86701456-86701478 GGGGTGCAGAAGCACCTTGTTGG No data
1056449412_1056449416 3 Left 1056449412 9:86701409-86701431 CCAGGTTGGCTTGCACCACAAGA No data
Right 1056449416 9:86701435-86701457 GAGAGGTAGAAGTGACATTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056449412 Original CRISPR TCTTGTGGTGCAAGCCAACC TGG (reversed) Intergenic
No off target data available for this crispr