ID: 1056449414

View in Genome Browser
Species Human (GRCh38)
Location 9:86701424-86701446
Sequence CTTCTACCTCTCACTTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056449414_1056449418 -10 Left 1056449414 9:86701424-86701446 CCACAAGAAGTGAGAGGTAGAAG No data
Right 1056449418 9:86701437-86701459 GAGGTAGAAGTGACATTCGGGGG No data
1056449414_1056449419 9 Left 1056449414 9:86701424-86701446 CCACAAGAAGTGAGAGGTAGAAG No data
Right 1056449419 9:86701456-86701478 GGGGTGCAGAAGCACCTTGTTGG No data
1056449414_1056449422 29 Left 1056449414 9:86701424-86701446 CCACAAGAAGTGAGAGGTAGAAG No data
Right 1056449422 9:86701476-86701498 TGGTAGCTTCTCCAATTCCTGGG No data
1056449414_1056449421 28 Left 1056449414 9:86701424-86701446 CCACAAGAAGTGAGAGGTAGAAG No data
Right 1056449421 9:86701475-86701497 TTGGTAGCTTCTCCAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056449414 Original CRISPR CTTCTACCTCTCACTTCTTG TGG (reversed) Intergenic
No off target data available for this crispr