ID: 1056449419

View in Genome Browser
Species Human (GRCh38)
Location 9:86701456-86701478
Sequence GGGGTGCAGAAGCACCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056449414_1056449419 9 Left 1056449414 9:86701424-86701446 CCACAAGAAGTGAGAGGTAGAAG No data
Right 1056449419 9:86701456-86701478 GGGGTGCAGAAGCACCTTGTTGG No data
1056449412_1056449419 24 Left 1056449412 9:86701409-86701431 CCAGGTTGGCTTGCACCACAAGA No data
Right 1056449419 9:86701456-86701478 GGGGTGCAGAAGCACCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056449419 Original CRISPR GGGGTGCAGAAGCACCTTGT TGG Intergenic
No off target data available for this crispr