ID: 1056451763

View in Genome Browser
Species Human (GRCh38)
Location 9:86723429-86723451
Sequence CAGAACCAATATGTGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056451760_1056451763 -10 Left 1056451760 9:86723416-86723438 CCTGAGATGAGAACAGAACCAAT No data
Right 1056451763 9:86723429-86723451 CAGAACCAATATGTGGTACAGGG No data
1056451757_1056451763 24 Left 1056451757 9:86723382-86723404 CCGTGTGAAAGGGGCAGGTAAAC No data
Right 1056451763 9:86723429-86723451 CAGAACCAATATGTGGTACAGGG No data
1056451756_1056451763 25 Left 1056451756 9:86723381-86723403 CCCGTGTGAAAGGGGCAGGTAAA No data
Right 1056451763 9:86723429-86723451 CAGAACCAATATGTGGTACAGGG No data
1056451755_1056451763 26 Left 1056451755 9:86723380-86723402 CCCCGTGTGAAAGGGGCAGGTAA No data
Right 1056451763 9:86723429-86723451 CAGAACCAATATGTGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056451763 Original CRISPR CAGAACCAATATGTGGTACA GGG Intergenic
No off target data available for this crispr