ID: 1056452584

View in Genome Browser
Species Human (GRCh38)
Location 9:86730437-86730459
Sequence ATCAGACATAGCTGCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056452584_1056452593 30 Left 1056452584 9:86730437-86730459 CCTCCATGGCAGCTATGTCTGAT No data
Right 1056452593 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG No data
1056452584_1056452590 28 Left 1056452584 9:86730437-86730459 CCTCCATGGCAGCTATGTCTGAT No data
Right 1056452590 9:86730488-86730510 TTCCCTTCTAGATTAAGATTTGG No data
1056452584_1056452591 29 Left 1056452584 9:86730437-86730459 CCTCCATGGCAGCTATGTCTGAT No data
Right 1056452591 9:86730489-86730511 TCCCTTCTAGATTAAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056452584 Original CRISPR ATCAGACATAGCTGCCATGG AGG (reversed) Intergenic
No off target data available for this crispr