ID: 1056452585

View in Genome Browser
Species Human (GRCh38)
Location 9:86730440-86730462
Sequence ATCATCAGACATAGCTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056452585_1056452591 26 Left 1056452585 9:86730440-86730462 CCATGGCAGCTATGTCTGATGAT No data
Right 1056452591 9:86730489-86730511 TCCCTTCTAGATTAAGATTTGGG No data
1056452585_1056452593 27 Left 1056452585 9:86730440-86730462 CCATGGCAGCTATGTCTGATGAT No data
Right 1056452593 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG No data
1056452585_1056452590 25 Left 1056452585 9:86730440-86730462 CCATGGCAGCTATGTCTGATGAT No data
Right 1056452590 9:86730488-86730510 TTCCCTTCTAGATTAAGATTTGG No data
1056452585_1056452595 28 Left 1056452585 9:86730440-86730462 CCATGGCAGCTATGTCTGATGAT No data
Right 1056452595 9:86730491-86730513 CCTTCTAGATTAAGATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056452585 Original CRISPR ATCATCAGACATAGCTGCCA TGG (reversed) Intergenic
No off target data available for this crispr