ID: 1056452587

View in Genome Browser
Species Human (GRCh38)
Location 9:86730464-86730486
Sequence GGGTACTGATTTCAGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056452587_1056452590 1 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452590 9:86730488-86730510 TTCCCTTCTAGATTAAGATTTGG No data
1056452587_1056452591 2 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452591 9:86730489-86730511 TCCCTTCTAGATTAAGATTTGGG No data
1056452587_1056452595 4 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452595 9:86730491-86730513 CCTTCTAGATTAAGATTTGGGGG No data
1056452587_1056452597 28 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452597 9:86730515-86730537 GAACTTCCTTTGCCATGTAAGGG No data
1056452587_1056452593 3 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452593 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG No data
1056452587_1056452596 27 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452596 9:86730514-86730536 AGAACTTCCTTTGCCATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056452587 Original CRISPR GGGTACTGATTTCAGCAGAA TGG (reversed) Intergenic
No off target data available for this crispr