ID: 1056452590

View in Genome Browser
Species Human (GRCh38)
Location 9:86730488-86730510
Sequence TTCCCTTCTAGATTAAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056452585_1056452590 25 Left 1056452585 9:86730440-86730462 CCATGGCAGCTATGTCTGATGAT No data
Right 1056452590 9:86730488-86730510 TTCCCTTCTAGATTAAGATTTGG No data
1056452584_1056452590 28 Left 1056452584 9:86730437-86730459 CCTCCATGGCAGCTATGTCTGAT No data
Right 1056452590 9:86730488-86730510 TTCCCTTCTAGATTAAGATTTGG No data
1056452587_1056452590 1 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452590 9:86730488-86730510 TTCCCTTCTAGATTAAGATTTGG No data
1056452586_1056452590 2 Left 1056452586 9:86730463-86730485 CCCATTCTGCTGAAATCAGTACC No data
Right 1056452590 9:86730488-86730510 TTCCCTTCTAGATTAAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056452590 Original CRISPR TTCCCTTCTAGATTAAGATT TGG Intergenic
No off target data available for this crispr