ID: 1056452593

View in Genome Browser
Species Human (GRCh38)
Location 9:86730490-86730512
Sequence CCCTTCTAGATTAAGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056452585_1056452593 27 Left 1056452585 9:86730440-86730462 CCATGGCAGCTATGTCTGATGAT No data
Right 1056452593 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG No data
1056452586_1056452593 4 Left 1056452586 9:86730463-86730485 CCCATTCTGCTGAAATCAGTACC No data
Right 1056452593 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG No data
1056452587_1056452593 3 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452593 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG No data
1056452584_1056452593 30 Left 1056452584 9:86730437-86730459 CCTCCATGGCAGCTATGTCTGAT No data
Right 1056452593 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056452593 Original CRISPR CCCTTCTAGATTAAGATTTG GGG Intergenic
No off target data available for this crispr