ID: 1056452595

View in Genome Browser
Species Human (GRCh38)
Location 9:86730491-86730513
Sequence CCTTCTAGATTAAGATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056452587_1056452595 4 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452595 9:86730491-86730513 CCTTCTAGATTAAGATTTGGGGG No data
1056452585_1056452595 28 Left 1056452585 9:86730440-86730462 CCATGGCAGCTATGTCTGATGAT No data
Right 1056452595 9:86730491-86730513 CCTTCTAGATTAAGATTTGGGGG No data
1056452586_1056452595 5 Left 1056452586 9:86730463-86730485 CCCATTCTGCTGAAATCAGTACC No data
Right 1056452595 9:86730491-86730513 CCTTCTAGATTAAGATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056452595 Original CRISPR CCTTCTAGATTAAGATTTGG GGG Intergenic
No off target data available for this crispr