ID: 1056452596

View in Genome Browser
Species Human (GRCh38)
Location 9:86730514-86730536
Sequence AGAACTTCCTTTGCCATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056452594_1056452596 0 Left 1056452594 9:86730491-86730513 CCTTCTAGATTAAGATTTGGGGG No data
Right 1056452596 9:86730514-86730536 AGAACTTCCTTTGCCATGTAAGG No data
1056452586_1056452596 28 Left 1056452586 9:86730463-86730485 CCCATTCTGCTGAAATCAGTACC No data
Right 1056452596 9:86730514-86730536 AGAACTTCCTTTGCCATGTAAGG No data
1056452588_1056452596 7 Left 1056452588 9:86730484-86730506 CCCATTCCCTTCTAGATTAAGAT No data
Right 1056452596 9:86730514-86730536 AGAACTTCCTTTGCCATGTAAGG No data
1056452592_1056452596 1 Left 1056452592 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG No data
Right 1056452596 9:86730514-86730536 AGAACTTCCTTTGCCATGTAAGG No data
1056452589_1056452596 6 Left 1056452589 9:86730485-86730507 CCATTCCCTTCTAGATTAAGATT No data
Right 1056452596 9:86730514-86730536 AGAACTTCCTTTGCCATGTAAGG No data
1056452587_1056452596 27 Left 1056452587 9:86730464-86730486 CCATTCTGCTGAAATCAGTACCC No data
Right 1056452596 9:86730514-86730536 AGAACTTCCTTTGCCATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056452596 Original CRISPR AGAACTTCCTTTGCCATGTA AGG Intergenic
No off target data available for this crispr