ID: 1056454148

View in Genome Browser
Species Human (GRCh38)
Location 9:86744243-86744265
Sequence GCCCGTTTCCTTTTGGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056454144_1056454148 11 Left 1056454144 9:86744209-86744231 CCTAGTGTCGGTTGCCTCTCTTT No data
Right 1056454148 9:86744243-86744265 GCCCGTTTCCTTTTGGTCACTGG No data
1056454143_1056454148 17 Left 1056454143 9:86744203-86744225 CCTTGACCTAGTGTCGGTTGCCT No data
Right 1056454148 9:86744243-86744265 GCCCGTTTCCTTTTGGTCACTGG No data
1056454145_1056454148 -3 Left 1056454145 9:86744223-86744245 CCTCTCTTTCCTCATCTCTTGCC No data
Right 1056454148 9:86744243-86744265 GCCCGTTTCCTTTTGGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056454148 Original CRISPR GCCCGTTTCCTTTTGGTCAC TGG Intergenic
No off target data available for this crispr