ID: 1056458943

View in Genome Browser
Species Human (GRCh38)
Location 9:86790894-86790916
Sequence TACTGAATTGGATTCAGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056458943_1056458947 17 Left 1056458943 9:86790894-86790916 CCCGAGCTGAATCCAATTCAGTA No data
Right 1056458947 9:86790934-86790956 CTATGCACAAGATTTGAGCTAGG No data
1056458943_1056458950 28 Left 1056458943 9:86790894-86790916 CCCGAGCTGAATCCAATTCAGTA No data
Right 1056458950 9:86790945-86790967 ATTTGAGCTAGGGTTTATGGAGG No data
1056458943_1056458949 25 Left 1056458943 9:86790894-86790916 CCCGAGCTGAATCCAATTCAGTA No data
Right 1056458949 9:86790942-86790964 AAGATTTGAGCTAGGGTTTATGG No data
1056458943_1056458948 18 Left 1056458943 9:86790894-86790916 CCCGAGCTGAATCCAATTCAGTA No data
Right 1056458948 9:86790935-86790957 TATGCACAAGATTTGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056458943 Original CRISPR TACTGAATTGGATTCAGCTC GGG (reversed) Intergenic
No off target data available for this crispr