ID: 1056458944

View in Genome Browser
Species Human (GRCh38)
Location 9:86790895-86790917
Sequence GTACTGAATTGGATTCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056458944_1056458949 24 Left 1056458944 9:86790895-86790917 CCGAGCTGAATCCAATTCAGTAC No data
Right 1056458949 9:86790942-86790964 AAGATTTGAGCTAGGGTTTATGG No data
1056458944_1056458947 16 Left 1056458944 9:86790895-86790917 CCGAGCTGAATCCAATTCAGTAC No data
Right 1056458947 9:86790934-86790956 CTATGCACAAGATTTGAGCTAGG No data
1056458944_1056458948 17 Left 1056458944 9:86790895-86790917 CCGAGCTGAATCCAATTCAGTAC No data
Right 1056458948 9:86790935-86790957 TATGCACAAGATTTGAGCTAGGG No data
1056458944_1056458950 27 Left 1056458944 9:86790895-86790917 CCGAGCTGAATCCAATTCAGTAC No data
Right 1056458950 9:86790945-86790967 ATTTGAGCTAGGGTTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056458944 Original CRISPR GTACTGAATTGGATTCAGCT CGG (reversed) Intergenic
No off target data available for this crispr