ID: 1056458947

View in Genome Browser
Species Human (GRCh38)
Location 9:86790934-86790956
Sequence CTATGCACAAGATTTGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056458944_1056458947 16 Left 1056458944 9:86790895-86790917 CCGAGCTGAATCCAATTCAGTAC No data
Right 1056458947 9:86790934-86790956 CTATGCACAAGATTTGAGCTAGG No data
1056458946_1056458947 5 Left 1056458946 9:86790906-86790928 CCAATTCAGTACTGGACTAGAGA No data
Right 1056458947 9:86790934-86790956 CTATGCACAAGATTTGAGCTAGG No data
1056458943_1056458947 17 Left 1056458943 9:86790894-86790916 CCCGAGCTGAATCCAATTCAGTA No data
Right 1056458947 9:86790934-86790956 CTATGCACAAGATTTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056458947 Original CRISPR CTATGCACAAGATTTGAGCT AGG Intergenic
No off target data available for this crispr