ID: 1056458948

View in Genome Browser
Species Human (GRCh38)
Location 9:86790935-86790957
Sequence TATGCACAAGATTTGAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056458946_1056458948 6 Left 1056458946 9:86790906-86790928 CCAATTCAGTACTGGACTAGAGA No data
Right 1056458948 9:86790935-86790957 TATGCACAAGATTTGAGCTAGGG No data
1056458944_1056458948 17 Left 1056458944 9:86790895-86790917 CCGAGCTGAATCCAATTCAGTAC No data
Right 1056458948 9:86790935-86790957 TATGCACAAGATTTGAGCTAGGG No data
1056458943_1056458948 18 Left 1056458943 9:86790894-86790916 CCCGAGCTGAATCCAATTCAGTA No data
Right 1056458948 9:86790935-86790957 TATGCACAAGATTTGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056458948 Original CRISPR TATGCACAAGATTTGAGCTA GGG Intergenic
No off target data available for this crispr