ID: 1056461169

View in Genome Browser
Species Human (GRCh38)
Location 9:86810933-86810955
Sequence CCTCACATGGAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056461169_1056461174 9 Left 1056461169 9:86810933-86810955 CCTTCCTCCTTTTCCATGTGAGG No data
Right 1056461174 9:86810965-86810987 GAAGCCTCCATCTGTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056461169 Original CRISPR CCTCACATGGAAAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr