ID: 1056464317

View in Genome Browser
Species Human (GRCh38)
Location 9:86838938-86838960
Sequence CCGCACGCACACGTAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056464317_1056464322 30 Left 1056464317 9:86838938-86838960 CCTGTGCCTACGTGTGCGTGCGG No data
Right 1056464322 9:86838991-86839013 ATTAGCCTGTTTCTCGCTGGCGG No data
1056464317_1056464320 3 Left 1056464317 9:86838938-86838960 CCTGTGCCTACGTGTGCGTGCGG No data
Right 1056464320 9:86838964-86838986 AGCTGCAATTTGACATCATGTGG No data
1056464317_1056464321 27 Left 1056464317 9:86838938-86838960 CCTGTGCCTACGTGTGCGTGCGG No data
Right 1056464321 9:86838988-86839010 AAGATTAGCCTGTTTCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056464317 Original CRISPR CCGCACGCACACGTAGGCAC AGG (reversed) Intergenic
No off target data available for this crispr