ID: 1056464322

View in Genome Browser
Species Human (GRCh38)
Location 9:86838991-86839013
Sequence ATTAGCCTGTTTCTCGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056464319_1056464322 24 Left 1056464319 9:86838944-86838966 CCTACGTGTGCGTGCGGCATAGC No data
Right 1056464322 9:86838991-86839013 ATTAGCCTGTTTCTCGCTGGCGG No data
1056464317_1056464322 30 Left 1056464317 9:86838938-86838960 CCTGTGCCTACGTGTGCGTGCGG No data
Right 1056464322 9:86838991-86839013 ATTAGCCTGTTTCTCGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056464322 Original CRISPR ATTAGCCTGTTTCTCGCTGG CGG Intergenic
No off target data available for this crispr