ID: 1056468147

View in Genome Browser
Species Human (GRCh38)
Location 9:86879126-86879148
Sequence CAGGGTCATCAGAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056468141_1056468147 2 Left 1056468141 9:86879101-86879123 CCATGCGGGGTATGTGGGGCAGC No data
Right 1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056468147 Original CRISPR CAGGGTCATCAGAAGGCAGA GGG Intergenic
No off target data available for this crispr