ID: 1056469799

View in Genome Browser
Species Human (GRCh38)
Location 9:86894289-86894311
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056469799_1056469802 1 Left 1056469799 9:86894289-86894311 CCCAGCTCCTTTTGGGAACGCTG No data
Right 1056469802 9:86894313-86894335 GTAACACACTGTCTTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056469799 Original CRISPR CAGCGTTCCCAAAAGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr