ID: 1056480213

View in Genome Browser
Species Human (GRCh38)
Location 9:86995774-86995796
Sequence TTATTTATACAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056480213_1056480219 9 Left 1056480213 9:86995774-86995796 CCCTCCTCCCTCTGTATAAATAA No data
Right 1056480219 9:86995806-86995828 TCTACTCTGAGGCTTCTCTAAGG No data
1056480213_1056480218 -2 Left 1056480213 9:86995774-86995796 CCCTCCTCCCTCTGTATAAATAA No data
Right 1056480218 9:86995795-86995817 AATTTCACATCTCTACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056480213 Original CRISPR TTATTTATACAGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr