ID: 1056480219

View in Genome Browser
Species Human (GRCh38)
Location 9:86995806-86995828
Sequence TCTACTCTGAGGCTTCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056480215_1056480219 5 Left 1056480215 9:86995778-86995800 CCTCCCTCTGTATAAATAATTTC No data
Right 1056480219 9:86995806-86995828 TCTACTCTGAGGCTTCTCTAAGG No data
1056480212_1056480219 10 Left 1056480212 9:86995773-86995795 CCCCTCCTCCCTCTGTATAAATA No data
Right 1056480219 9:86995806-86995828 TCTACTCTGAGGCTTCTCTAAGG No data
1056480211_1056480219 22 Left 1056480211 9:86995761-86995783 CCATTAATTTTTCCCCTCCTCCC No data
Right 1056480219 9:86995806-86995828 TCTACTCTGAGGCTTCTCTAAGG No data
1056480216_1056480219 2 Left 1056480216 9:86995781-86995803 CCCTCTGTATAAATAATTTCACA No data
Right 1056480219 9:86995806-86995828 TCTACTCTGAGGCTTCTCTAAGG No data
1056480214_1056480219 8 Left 1056480214 9:86995775-86995797 CCTCCTCCCTCTGTATAAATAAT No data
Right 1056480219 9:86995806-86995828 TCTACTCTGAGGCTTCTCTAAGG No data
1056480217_1056480219 1 Left 1056480217 9:86995782-86995804 CCTCTGTATAAATAATTTCACAT No data
Right 1056480219 9:86995806-86995828 TCTACTCTGAGGCTTCTCTAAGG No data
1056480213_1056480219 9 Left 1056480213 9:86995774-86995796 CCCTCCTCCCTCTGTATAAATAA No data
Right 1056480219 9:86995806-86995828 TCTACTCTGAGGCTTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056480219 Original CRISPR TCTACTCTGAGGCTTCTCTA AGG Intergenic
No off target data available for this crispr