ID: 1056481830

View in Genome Browser
Species Human (GRCh38)
Location 9:87013552-87013574
Sequence TTGGTATTGAGCCCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056481827_1056481830 29 Left 1056481827 9:87013500-87013522 CCACTAACATTCTGCTTGGTGAT No data
Right 1056481830 9:87013552-87013574 TTGGTATTGAGCCCAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056481830 Original CRISPR TTGGTATTGAGCCCAAAACC AGG Intergenic
No off target data available for this crispr